Molbio_wz2

Report
Werkzitting II
Prof. F. Claessens
Definities
Escherichia coli
Bacteriofaag
Attenuatie
Promotor
Nucleosoom
Wobble
Nucleotide excision repair
Leucine zipper
Meerkeuzevragen:
Een mRNA heeft 1, 2, 3 of 4 leesramen.
Een DNA streng heeft 2, 4, 6 of 8 leesramen.
AUG GCC CAG GCU A
A UGG CCC AGG CUA
AU GGC CCA GGC UA
Een monomeer DNA-bindend domein contacteert meestal ongeveer_____
A. Één bp
B. 12 bps
C. 6 bps
D. 2 bps
Welke component staat in voor de herkenning van de ribosoom-bindingsplaatsen?
A. eIFs
B. tRNAi
C. 23S rRNA
D. 16S rRNA
De regeling van de expressie van het lactose operon door een tekort aan glucose,
wordt ___genoemd.
A. De-repressie
B. Activatie
C. Attenuatie
D. Repressie
Welke van deze vier is GEEN codon voor Arginine?
A. CGA
B. CGU
C. AGA
D. AGU
A
B
C
E
D
B C
E
D
B
C
D F
E
Duidt aan:
5’UTR
ORF
Stopcodon
3’UTR
Startcodon
RBS
Hieronder staat de sequentie van het eerste exon van een gen.
Geef de eerste aminozuren van het eiwit dat hierdoor gekodeerd wordt
GCCGGATATGCCAATATGCTTTCCCGGG…
GCCGGAU AUG CCA AUA UGC UUU CCC GGG…
Uit een kleine hoeveelheid van een eiwit hebt u
de volgende fragmenten kunnen identificeren:
Trp Met His His Lys
Leu Ser Arg Leu Arg
Ontwerp een oligonucleotide die als probe kan dienen om het mRNA dat voor dit eiwit
te identificeren
Trp Met His His Lys
Leu Ser Arg Leu Arg
Wat is het effect van deze mutatie?
A. De insertie van één nucleotide nabij het einde van een mRNA
B. Deletie van één nucleotide in de eerste twintig codons van een ORF
C. Deletie van drie opeenvolgende nucleotiden middenin een ORF
D. Een mutatie van de onderlijnde C in GCCGGAU’AUG’CCA’AUA’UGC…
naar U,
naar G
naar A
Het DNA fragment tussen de twee pijlen moet worden geamplificeerd.
Welke DNA primers zou u daar voor nemen?
AGGCTATATAATTTAAGCTAGATACCAGATAGATACCCCACCAA
AAGTCATCAGTATAAAGATCAGATCAGGTCCCGAATTACGGTC
TGTTCTTAACGAGTTATTCCCGCCGTAATACATGGTACCTGACA
A.
B.
C.
D.
AGGCTATATAATT
TAAGCTAGATACC
ATTCGATCTATGG
AATTATATAGCCTT
A.
B.
C.
D.
TACATGGTACCTGACA
ATTACGGCGGGAA
TTCCCGCCGTAAT
CAGGTACCATAGTA

similar documents