34. Quantitative Insights Into Microbial Ecology

Report
Analysis of microbial communities
with QIIME
Justin Kuczynski
February 2012
Because Microbial communities are important
Microbial communities are important
Microbial communities are important
Microbial communities are important
photos: stockphoto.it, eurasnet.info, elkhorn.unl.edu
One option: 16S / SSU sequence based profiling
Focus on the ribosomal SSU / 16S gene
Target and amplify the
16S/18S ribosomal RNA
as a ‘fingerprint’ for
different taxonomic
groups.
Why 16S/18S?
- gene is ubiquitous
- contains conserved and
variable regions
SSU / 16S experimental workflow
Extract DNA and
amplify marker gene
with barcoded primers
Pool amplicons and
sequence
Sequences are not directly
interpretable
line 12,000
of 1.2 M
Sequences are not directly
interpretable
And beware:
▫
▫
▫
▫
line 12,000
of 1.2 M
chimeric PCR products
sequencing error
uneven sequencing depth
short read effects
From sequences to results
From sequences to results
E. Costello et al., 2009
That is QIIME’s purpose
Extract DNA and
amplify marker gene
with barcoded primers
>GCACCTGAGGACAGGCATGAGGAA…
>GCACCTGAGGACAGGGGAGGAGGA…
>TCACATGAACCTAGGCAGGACGAA…
>CTACCGGAGGACAGGCATGAGGAT…
>TCACATGAACCTAGGCAGGAGGAA…
>GCACCTGAGGACACGCAGGACGAC…
>CTACCGGAGGACAGGCAGGAGGAA…
>CTACCGGAGGACACACAGGAGGAA…
>GAACCTTCACATAGGCAGGAGGAT…
>TCACATGAACCTAGGGGCAAGGAA…
>GCACCTGAGGACAGGCAGGAGGAA…
Assign reads to
communities
www.qiime.org
Pool amplicons and
sequence
Assign millions of
sequences from
thousands of
communities to OTUs
Visualize and compare
community relationships
QIIME analysis in more detail
QIIME analysis in more detail
QIIME analysis in more detail
beta_diversity_through_plots.py
QIIME analysis example
beta_diversity_through_plots.py
QIIME analysis example
QIIME analysis example
QIIME analysis example
Demo of beta diversity analysis results
Demo of beta diversity analysis results
QIIME tech support
• www.qiime.org
• Overview Tutorial
• QIIME forum
Running QIIME
Laptop
images: pcdownload.asia, ostatic.com
EC2
Cluster
Acknowledgements
RESEARCH
FUNDING
Crohn’s and Colitis Foundation of America, the
Bill and Melinda Gates Foundation, NASA, the
HHMI and the NIH
[email protected]
www.qiime.org
Antonio González
Bharath Prithiviraj
Catherine Lozupone
Chris Lauber
Dan Knights
Daniel McDonald
Donna Berg-Lyons
Doug Wendel
Greg Caporaso
Jens Reeder
Jerry Kennedy
Jess Metcalf
Jesse Stombaugh
Jesse Zaneveld
José Clemente
Justin Kuczynski
Laura Parfrey
Meg Pirrung
Rob Knight
Tony Walters
Ulla Westermann
Will Van Trueren

similar documents