T.P Nº 3: Diseño de oligonucleótidos

Report
T.P Nº 8: Diseño de
oligonucleótidos
Objetivo: Diseño de
oligonucleótidos adecuados para la
amplificación mediante PCR de un
fragmento interno del gen rpoS en
Ps. alcaligenes
RpoS
Estrés: ayuno en nutrientes, pH ácido, alta osmolaridad
RpoS o S
Genes que confieren resistencia al estrés, genes
involucrados en re-arreglos morfológicos y genes que
provocan cambios en el metabolismo celular
Procedimiento
1) En base de datos de secuencias proteicas buscar
secuencias correspondientes a RpoS de Pseudomonas.
2) Elegir 4 de estas secuencias y armar con ellas un
archivo en formato FASTA
3) Buscar las regiones de homología utilizando el
ClustalW
ClustalW
Procedimiento
4) Elegir regiones de homología situadas a una
distancia adecuada (50 aa = 150 nucleótidos)
5) Reconstruir la secuencia nucleotídica de los
nucleótidos elegidos, teniendo en cuenta los diferentes
codones para un mismo aminoácido y el uso de codones
para P. alcaligenes
Ejemplo
1) Secuencia aminoacídica elegida
PDA(A o E)WDG
2) Reconstrucción de secuencia nucleotídica
Código genético
A (Ala)
R (Arg)
N (Asn)
D (Asp)
C (Cys)
Q (Gln)
E (Glt)
GCA
GCC
GCG
GCT
CGA
CGC
CGG
CGT
AGA
AGG
AAC
AAT
GAC
GAT
TGC
TGT
CAA
CAG
GAA
GAG
G (Gly)
H (His)
I (Ile)
L (Leu)
K (Lys)
M (Met)
F (Fen)
GGA
GGC
GGG
GGT
CAC
CAT
ATA
ATC
ATT
CTA
CTC
CTG
CTT
TTA
TTG
AAA
AAG
ATG
TTC
TTT
P (Pro)
S (Ser)
T (Thr)
W (Trp)
Y (Tyr)
V (Val)
CCA
CCC
CCG
CCT
TCA
TCC
TCG
TCT
AGC
AGT
ACA
ACC
ACG
ACT
TGG
TAC
TAT
GTA
GTC
GTG
GTT
Codon usage para P oleovorans
AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln
GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCATCAA
C G C CT CAGC C C
T C C C G
A
A A
A A
G
G G
G G
Elegir la region de 18 a 21 nucleotidos menos
“degenerada”
Un total de 32 oligonucleotidos se generan para dar lugar al peptido .
TATTGTTGGCTTCC
TACTGTTGGCTTCC
TATTGCTGGCTTCC
TACTGCTGGCTTCC
etc.
Nomenclatura para nucleótidos degenerados
Nucleótidos degenerados:
B=CóGóT
D=AóGóT
H=AóCóT
K=GóT
M=AóC
N=AóCóGóT
R=AóG
S=GóC
V=AóCóG
W=AóT
Y=CóT
Nucleótidos
complementarios
C–G
A-T
B–V
D-H
K–M
N-N
R–Y
S–S
W –W
Para diseñar primers
•
Tamaño del oligonucleótido y del producto
•
Temperatura de fusión (Tm)
•
Especificidad
•
Secuencias complementarias
•
Contenido en G/C y cadenas de polipirimidinas (T, C) o polipurinas (A,
G)
•
Secuencia 3’ terminal.
•
Secuencia 5’ terminal y regiones centrales
•
Tamaño del oligonucleótido
18 a 24 bases
Temperatura de fusión (Tm)
Tm = 2(A+T) + 4(G+C)
Tamaño
del
Oligonucleótido
4
6
8
10
12
14
16
18
20
Tm = 2 (A+T) +
4(G+C)
12°C
18°C
24°C
30°C
36°C
42°C
48°C
54°C
60°C
Tann: 5- 8 °C más baja que la de fusión
Tamaño
del
Oligonucleótido
22
24
26
28
30
32
34
36
38
Tm = 2 (A+T) +
4(G+C)
66°C
72°C
78°C
84°C
90°C
96°C
102°C
108°C
114°C
• Contenido en G/C
45% al 55%
Ideal mezcla al azar un contenido en
GC del 50% y ~ 20 bases (la Tm
estaría en el rango de 56°C –
62°C).
• Complementariedad
NO estructuras secundarias o
dímeros o doble cadena
• Secuencia 3’-terminal
CG Clamp
• Secuencia 5’-terminal y
regiones centrales
CG Clamp
Resumén de Criterios “positivos” para el diseño de
primers
Temperatura de fusión (Tm)
TmForward = TmReverse
Tm = 55-62ºC
T hibridación ~ 5-8ºC menos que la Tm
Tamaño del primer
12-30 b, óptimo 18 a 24 b
Distancia entre primers
10 b-10 kb
Contenido en G+C
>= secuencia diana; ideal del 45% al 55%
“cepo GC” en 3’
termina en T; G o C en dos (máx.) de cinco últimas
bases
“cepo GC” en 5’
incluir varias G o C en las últimas bases
Lugares de apareamiento de de
primers
únicos
Diseño de oligonucleótidos
para Reacción en cadena de
la polimerasa (PCR)
Online
http://molbiol-tools.ca/PCR.htm
Diseño de oligonucleótidos
para Reacción en cadena
de la polimerasa (PCR)
Uso del programa DNAMAN

similar documents