Northern blot

Report
TECNICAS
MOLECULARES
Francisca Burgos V
08-11
Inmunoensayos
• Conjunto de técnicas inmunoquímicas analíticas de
laboratorio.
• Complejos inmunes = conjugación de anticuerpos y
antígenos, como referencias de cuantificación de un
analito (sustancia objeto de análisis) determinado, que
puede ser el anticuerpo (Ac) o un antígeno (Ag).
• Medir molécula como marcador que hace parte de la
reacción con el complejo inmune en la prueba o
ensayo químico.
Inmunoensayos
• Gran especificidad y afinidad de los anticuerpos por sus
antígenos específicos.
• Usan los anticuerpos monoclonales (obtenidos en el
laboratorio, más específicos ) o de sueros policlonales
(obtenidos de animales).
• Gran sensibilidad y especificidad permite la
cuantificación de compuestos presentes en líquidos
orgánicos en concentración reducida (nanogramos/ml o
de picogramos/ml).
• El desarrollo del inmunoensayo ha tenido gran impacto
en el campo del diagnostico médico mediante pruebas
de laboratorio o química clínica.
Usos de Inmunoensayos
• Medición de niveles de hormonas: por ejemplo la medición de
niveles de hormonas tiroideas o de estrógenos
• Medición de metabolitos en suero cuya cantidad o presencia son
indicios de daño celular: Por ejemplo la medición de marcadores
biológicos miocárdicos como las troponinas
• Detección de virus: por ejemplo de los causantes de hepatitis y su
individualización
• Detección del cáncer o de células tumorales: a través de sus
proteínas o marcadores tumorales, liberados en el suero de los
pacientes.
• Detectar exposición a agentes infecciosos: por ejemplo de rubéola
o toxoplasmosis en mujeres embarazadas o en personas
inmunosuprimidas.
• Detección de metabolitos indicadores de problemas fisiológicos,
por su presencia o cantidad excesiva, en la sangre : por ejemplo
en caso de anemia se mide niveles de ferritina.
• Medir niveles de medicamentos, drogas objeto de abuso y toxinas
en sangre.
Tipos de inmunoensayos
• Por la técnica de medición
• Competitivo: Antígeno (Ag) objeto de la medición
compite con un antígeno marcado por un anticuerpo
(Ac).
• Mide la cantidad del antígeno marcado sin conjugar que
se considera es inversamente proporcional al analito.
Por la técnica de medición
• No competitivo (tipo sándwich): el Ag de la
muestra reacciona con dos Ac diferentes que se
fijan a distintas partes del Ag .
• Uno de los Ac generalmente está en soporte sólido
para facilitar la separación de la fracción ligada, y el
otro Ac lleva la marca.
• Se mide por la cantidad del marcador considerando
que es directamente proporcional a la cantidad del
analito.
1. Método Directo: Reacción inmune del Ag
con Acs conjugados con enzima
• Unión de un Ac primario, conjugado con
una enzima , con la consiguiente
formación del Ac primario conjugado que
se une al Ag, visualizándose la reacción
Ag- Ac,
Método Directo: Unión de un anticuerpo
primario (2) conjugado con una enzima (3), con
la consiguiente formación del anticuerpo
primario conjugado, que se une al antígeno (1).
2. Método indirecto de dos pasos
• En este método existen dos anticuerpos: El Ac primario unido al Ag,
que se revela a través de un Ac secundario previamente conjugado
con una enzima (anti- Ig), con la consiguiente formación del Ac
secundario conjugado que se une al Ac primario, visualizándose la
reacción
antiIg.
Tiene una gran capacidad de detectabilidad, pero la desventaja
principal radica en el número incrementado de pasos de incubación
y el gran número de controles requeridos
Figura 2
Método Indirecto de dos pasos: El anticuerpo
primario (2) unido al antígeno (1) se revela a través
de un anticuerpo secundario (3), previamente
conjugado con la enzima (4).
3. Método indirecto de tres pasos
• Consiste en un Ac terciario conjugado
que reacciona con un Ac secundario
conjugado previamente, unido al Ac
primario.
Figura
3
Método Indirecto de tres pasos:
Anticuerpo terceario (5) conjugado
con una enzima (6), reacciona con
un anticuerpo secundario (3)
conjugado con otra enzima (4),
previamente unido al anticuerpo
primario (2).
Tipos de Inmunoensayos
• Por el medio donde se realiza la medición
• Homogéneo: Señal generada por la unión del antígeno y el
anticuerpo se mide directamente en el mismo medio que se
utiliza para favorecer la formación del complejo inmune.
• Heterogéneo: En este tipo de ensayo la señal generada por
la unión del antígeno y el anticuerpo se mide en un medio
diferente que el utilizado para la unión del complejo inmune,
generalmente implican una etapa intermedia de lavado para
eliminar interferencias.
• Se considera que los inmunoensayos con formato
homogéneo no competitivo son los más sensibles y
específicos.
Tipos de Inmunoensayos
• Por el marcador
• Radioinmunoensayo (RIA) : el marcador es un isótopo
radioactivo.
• Enzimoinmunoanálsis (EIA): el marcador es una enzima como
por ejemplo la técnica de enzimoinmunoensayo conocido por su
abreviatura ELISA.
• Fluoroinmunoanálisis: el marcador
fluorescente, por ejemplo FPIA.
es
una
molécula
• Ensayo Inmunoquimioluminiscente: la marca es en general
una enzima capaz de catalizar una reacción quimioluminiscente.
Son tanto o mas sensibles que los radioinmunoensayos, y no
presentan riesgos de manipulación de sustancias radioactivas.
En contraposición estan poco desarrollados y no siempre es
posible aplicarlos.
DOT BLOT TIPO ELISA
• Se basa en la reacción antígeno-anticuerpo
• Es de tipo cualitativo
• Se emplea un anticuerpo que reconoce
específicamente un determinado antígeno (ej., una
cepa bacteriana)
• Luego un segundo anticuerpo (usualmente
conjugado ej., una enzima) es añadido a la reacción
para el reconocimiento del primer anticuerpo.
• Finalmente el sustrato es adicionado para que
reaccione con la enzima y de cómo resultado una
reacción visible.
DOT BLOT TIPO ELISA
• Simplificación de los métodos northern blot,
Southern blot, ó Western blot.
• Biomoléculas para ser detectados no son
separadas por cromatografía.
1. Una gota que contiene la molécula se aplica
directamente sobre una membrana.
2. Detección por sondas de nucleótidos (northern
blot y southern blot) ó anticuerpos (para un
western blot).
DOT BLOT TIPO ELISA
• Ahorro de tiempo.
• Confirma la presencia o ausencia de una
biomolécula o biomoléculas que pueden ser
detectados por las sondas de ADN o el anticuerpo.
• No ofrece información sobre el tamaño de la
biomolécula blanco. Si dos moléculas de diferentes
tamaños son detectadas, se seguirá viendo como un
solo punto.
• Una muestra radiactiva puede ser hibridizada para
permitir al investigador detectar la variación entre
muestras.
Southern Blot
• Southern
blot,
hibridación
simplemente, Southern.
Southern
o,
• Detecta la presencia de una secuencia de ADN en
una mezcla compleja de este ácido nucleico.
• Emplea la técnica de electroforesis en gel de agarosa
con el fin de separar en base a la longitud de los
fragmentos de ADN y, después, una transferencia a
una membrana en la cual se efectúa la hibridación de
la sonda.
Northern blot
• Northern blot es una técnica de detección de moléculas de
ácido ribonucleico (ARN) de una secuencia dada dentro de una
mezcla compleja.
• Someter a una electroforesis en gel a fin de separar los
fragmentos en base a su tamaño.
• Transferencia del contenido del gel, a una membrana cargada
positivamente en la cual se efectúa la hibridación de una sonda
molecular marcada radiactiva o químicamente.
Aplicaciones del Northern blot
• Permite observar un patrón particular de expresión genética
entre tejidos, órganos, estadios del desarrollo, niveles de
estrés ambiental, infecciones causadas por patógenos y
durante el curso del tratamiento de las mismas.
• Mostrar sobreexpresión de oncogenes y la desregulación de
genes supresores tumorales en células cancerosas cuando
son comparadas con tejidos normales.
• La variación en el tamaño del producto de un gen puede
además indicarnos deleciones o errores en el proceso de
transcripción.
• Alterando la sonda podemos conocer la secuencia e incluso
determinar que región del RNA ha sido delecionada
Ventajas y desventajas del Northern blot
• Detecta pequeños cambios en la expresión de genes
que los microarrays no pueden identificar.
• Desventaja: Degradación de la muestra por RNAsas
(endógenas de la muestra o a través de
contaminación ambiental)
• Puede ser evitada por una apropiada esterilización
de los materiales asó como el uso de inhibidores de
RNAsas como el dietilpirocarbonato.
Western blot
• Inmunoblot, es una técnica analítica usada para detectar
proteínas específicas en una muestra determinada (una
mezcla compleja de proteínas, como un extracto
tisular/cantidad relativa).
• Mediante una electroforesis en gel se separan las proteínas
atendiendo al criterio que se desee: peso molecular,
estructura, hidrofobicidad, etc.
• Transferencias a una membrana adsorbente (típicamente de
nitrocelulosa o de PVDF) para poder buscar la proteína de
interés con anticuerpos específicos contra ella.
• Detecta la unión antígeno-anticuerpo
enzimática, fluorescencia.
por
actividad
Colony blot
• Plaque OR Colony Blotting Techniques –
• Se utiliza para identificar las colonias de bacterias contiene el
ADN de interés entre los miles de personas.
• Colonias bacterianas son transferidas
membrana de nylon con recubrimiento.
a
nitrocelulosa
o
• Debido a la carga negativa de la superficie celular, algunas
células se unen a la membrana de nitrocelulosa.
• Membrana se coloca en una solución de NaOH 0,5 N para
romper la superficie de la célula, convertir DNA de doble cadena
en ADN de cadena simple y unirse al ADN a la membrana.
• Posteriormente, la membrana se transfiere a una solución que
contiene solución de proteasa después de neutralizar con una
solución de neutralización.
Colony blot
• Observar: Una colonia donde el ADN da hibridación
positiva.
• La ventaja de este método es que se pueden hacer
varias copias idénticas de ADN a partir de una placa
maestra.
ELISA
• Enzyme Linked Inmunoabsorbent Assay
• Procedimiento de inmunodetección cualitativo y
cuantitativo
• Se aplica en el diagnóstico de enfermedades y en
investigación
(estudios
inmunológicos,
endocrinológicos, expresión de proteínas)
• Basado en el uso de anticuerpos mono o policlonales,
los cuales pueden reconocer al antígeno de interés
en una mezcla no purificada de antígenos.
• El proceso de determinación involucra el uso de una
serie de anticuerpos los cuales forman un complejo
de antígenos-anticuerpo/anticuerpo-enzima/sustrato
Inmunohistoquímica
• Procedimiento histopatológico basado en la utilización de un
anticuerpo específico, previamente marcado mediante un
enlace químico con una enzima que puede transformar un
sustrato en visible, sin afectar la capacidad del anticuerpo para
formar un complejo con el antígeno, aplicado a una muestra de
tejido orgánico, correctamente fijada e incluida en parafina.
• Detección de antígenos sobre cortes histológicos mediante
anticuerpos mono o policlonales.
• Con la utilización de alguna de las técnicas específicas
(peroxidasa antiperoxidasa, fluoresceína, etc.), el complejo
antígeno - anticuerpo así formado puede localizarse e
identificarse en las muestras tisulares o citológicas a estudiar,
con lo que se identifican los marcadores antigénicos
característicos de distintas líneas de diferenciación y
funcionalismo celular y se determina el tipo de célula
involucrado en la muestra.
Inmunohistoquímica
1.- Antígeno de PSA (prostatic
specific antígeno o antígeno
prostático
especifico)
es
expresado
en
las
células
prostáticas.
Entonces, para detectar el
antígeno del PSA se crea un
anticuerpo anti-PSA.
2.- c-kit (CD117), es un factor de
transcripción celular.
Este antígeno es expresado en
tumores conocidos como GISTs
(gastrointestinal stromal tumors o
tumores
stromales
gastrointestinales).
Polimorfismo en la Longitud de los
Fragmentos de Restricción (RFLP)
• El DNA genómico extraído de células se digiere con enzimas
de restricción selectiva.
• Digeridos se someten a una electroforesis en gel de agarosa,
el DNA se desnaturaliza en tiras de una sola cadena y el
patrón de los fragmentos se transfiere a una membrana de
soporte, mediante Southern blot.
• Los fragmentos de DNA, se hibridan con una sonda
específica para el sitio x, marcado con material radioactivo
drb1 y aparecen como patrones de bandas aisladas de
tamaño específico (kB).
• Si los cebadores hibridizan con la muestra de DNA, es visible
una banda (la cual indica la presencia del alelo x particular).
• Falta de amplificación implica la ausencia de esa secuencia
alélica particular en la muestra de DNA.
Primers de secuencia específica (SSP)
• DNA de la muestra (células, tejidos) + Mezclar
cebadores (especificidad para las secuencias
características de cada uno de los alelos del sitio x
que se desea tipificar).
• Colocar alícuotas de la muestra en tubos
separados cada uno contiene un conjunto de
cebador específico y se amplifica en un
termociclador.
• Los productos amplificados son objeto de
electroforésis y se tiñen con bromuro de
etidio y se fotografía bajo luz UV.
• Si hibridizan con la muestra de DNA, se
hace visible una banda (la cual indica la
presencia del alelo x particular).
• La falta de amplificación implica la ausencia
de esa secuencia alélica particular en la
muestra de DNA.
Sondas de oligonucleótidos
especificas de secuencias (SSOP)
• Las sondas de oligonucleótido son
segmentos cortos de DNA de tira simple, de
18 a 24 nucleótidos.
• Cada uno constituido por una secuencia de
nucleótido complementaria a un motivo de
secuencia particular que se encuentra
dentro de las regiones invariables de los
alelos x individuales.
• Estas sondas solo hibridan con sus
secuencias exactamente complementarias en
condiciones estrictas de hibridación.
• Aún la diferencia de un simple par de bases
hace que las sondas se separen del pareado
con el DNA blanco.
• Está propiedad de especificidad perfecta de
secuencia brinda a este modelo de
tipificación una mayor resolución de alelos x
buscados.
Tipificación basada en secuencia
(SBT)
• DNA de una célula o tejido + amplificar
mediante la PCR con el uso de cebadores de
sitio o específicos a grupo.
• El producto amplificado se distribuye en
cuatro tubos, cada uno de los cuales tiene
polimerasa,
dNTP
y
mezclas
de
establecimiento de secuencia .
• Cada una de estas mezclas esta marcada
con un terminador de secuencia marcado
con fluorescencia.
• El tubo 1 contiene citosina marcada;el tubo
2, guanina marcada; el tubo 3, timina
marcada y el tubo 4, adenina marcada.
• El producto se amplifica mediante la PCR
para incorporar los terminadores marcados.
• Los cuatro tubos de muestra se mezclan y se
sujetan a electroforésis para formar una
escalera de secuencia, la cual se rastrea por
un láser para generar un electroferograma
de secuencia del DNA.
• Con el uso de programas de computadora
se compara la secuencia con la biblioteca
de secuencias de antígenos x y se
asignan los antígenos x
Tipificación VNTR
• El genoma humano contiene trechos de
secuencias sumamente repetitivas, que a
menudo se presentan en agrupamientos.
• El numero de repeticiones en un
agrupamiento varia entre individuos y da
lugar a un número variable de duplicados
colocados en tándem (VNTR).
• Este polimorfismo puede traducirse en
fragmentos de amplitud variable para
amplificación con la PCR mediante
primers diseñados para amplificar la
región de la repetición.
• Los VNTR tienen clásicamente una
longitud de 10 a 50 bases, también se
usan polimorfismos genéticos de
secuencias cortas conocidas como
duplicados cortos en hilera (STR) de 4 a
9 pb de longitud, para la determinación
de “huellas digitales” de DNA.
• Los VNTR pueden analizarse con electroforesis
del DNA ya sea genómico o amplificado por la
PCR.
• Una aplicación de los VNTR es la vigilancia del
establecimiento del injerto en receptores de
transplante de médula ósea.
• Los análisis de VNTR se usan como un
marcador genético con aplicaciones tanto
clínicas como forenses.
PCR: Reacción en Cadena de la Polimerasa. Reacción de extención de
partidores (cebadores, primers) utilizada para amplificar ácidos nucleicos.
Un pequeño fragmento de
ADN (< 3000pb) es
amplificado millones de veces
Permite determinar tamaño,
secuencia de nucleotidos, etc
Técnica muy utilizada en
Biología de poblaciones.
Permite trabajar con pequeñas
cantidades de ADN
Permite trabajar con muestras
de museo muy antiguas
Consideraciones generales
Temperatura de anillamiento: directamente relacionada con el
contenido de G-C, A-T. La temperatura de PCR depende de la
longitud y composición de los partidores.
T-A = x 2
G-C = x 3
Longitud del primer: debe ser lo suficientemente complejo para que
la prob de anillamiento con otra secuencia sea baja. Se recomienda
que un primer tenga como mínimo 17 bases de longitud.
a) Primers deben tener una longitud de 17-28b
b) Contenido G-C debe ser de alrededor del 50-60%
c) Se recomiendan Tms entre 50-75°C
d) Evitar 3 o más C o Gs en la región terminal 3’
e) Terminaciones 3’ no deben ser complementarias para evitar la formación
de dímeros
f)
Los primers no deben formar secuencias autocomplementarias para evitar
la formación de estructuras secundarias.
PCR
Partidores
LCO1490: 5’ –GGTCAACAAATCATAAAGATATTGG –3’
HCO2198: 5’ –TAAACTTCAGGGTGACCAAAAAATCA
–3’
Además:
(Folmer et al.,
1994)
MgCl
2
10x PCR Buffer
DNTP’s
800 pb
H20
Taq pol
Fragmento
es purificado y
ADN (20ng)
enviado a secuenciar
Gel de agarosa (1%) teñido con Et-Br
Secuenciación
Método enzimático de terminación de cadena o
método didesoxi de Sanger
Frederick Sanger
• Fragmento de ADN abundante (clonación o
PCR)
• Polimerasa ADN
• Primer
• Cuatro nucleótidos trifosfato (dATP, dCTP,
dGTP y dTTP).
• Cuatro didesoxi-nucleótidos (ddATP, ddTTP,
ddCTP y ddGTP).
Didesoxi-nucleotidos son nucleótidos
modificados que terminan la elongación.
Método enzimático de terminación de
cadena o método didesoxi de Sanger
Método Automático de Secuenciación
Variabilidad de la secuencia de ADN
ATTCGCTATCGAACGCTACGCTGCGAACGGG
Hebra original
ATTCGTTATCGAACGCTACGCTGCGAACGGG
Sustitución
ATTCGCTATCGAA- - -TACGCTGCGAACGGG
Deleción
ATTCGCTATCGAACGCCGCTACGCTGCGAACGGG
Repetición
ATTCG - - - CGAACGCTACGCTGCTATCGAACGGG
Transposición
RAPD (Random Amplified Polimorphism DNA)
Especímen A
Especímen B
Polimorfismo de
secuencia en el
sitio del partidor
• Marcador dominante (presencia ausencia)
• Utiliza partidores universales al azar (10pb)
• Permite amplificar fragmentos entre 200-2000pb
• Permite amplificar varios loci al mismo tiempo
Utilidad:
- Cartografía genética
- Hibridación
- Estructura genética de poblaciones
1
1
1
1
1
1
1
1
1
1
1
1
1
0
1
0
1
0
1
1
1
0
1
1
1
1
0
1
1
1
1
1
1
1
1
1
1
1
1
0
1
1
1
1
1
1
0
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
Matriz de datos es llevada a al
programa TFPGA
1
1
1
0
1
1
1
1
0
1
1
1
1
0
1
1
1
1
1
1
1
1
0
1
1
1
1
1
1
1
0
1
1
1
1
0
1
1
1
0
1
1
1
1
0
Ventajas
• Fácil y barato
• Aproximación multilocus
• No requiere el diseño de partidores específicos
• Permite analizar un gran número de loci a nivel genómico
• Su variabilidad es neutra a los efectos de la selección natural
Desventajas
• Reducción de la diversidad alélica (sólo 2 alelos)
• Es un marcador dominante, no se pueden detectar heterocigotos
• Alto nivel de Homoplasia
Dos bandas de igual tamaño pueden tener distintas
secuencias
Ausencia de banda puede ser producto de una o varias
mutaciones
• Exhibe graves problemas de reproducibilidad y poco comparables
• En muchos casos son imprecisos
• Técnicas y analíticas
AFLP (Amplified Fragment Length
Polymorphism)
Técnica popular que
permite detectar una
gran cantidad de
marcadores de ADN
polimórficos
rápidamente.
Involucra una digestión
con enzimas de
restricción y dos rondas
de PCR
ADN
1) Digestion con enzimas de
restricción (EcoRI, MseI)
CAAT T C C
G T TAAG G
C G TAAC C
GCATTGG
2) Ligación de adaptadores
AATTC
T TA
TTAA G
AAT
Permite detectar
presencia-ausencia de Adaptador EcoR I
fragmentos de
restricción.
Adaptador Mse I
3) PCR preselectivo
Primer 1 5’ --------- + A EcoR I
AATTCN
Fragmentos de ADN
con adaptadores
TTAA GN
NT TA
NAAT
C --------- 5’ Primer Mse I
Genera fragmentos de ADN entre 100-1500pb
4) PCR selectivo con
partidores fluorescentes
Primer 3 5’ --------- + AAC
AATTCA
TTAAGT
GTTA
CAAT
AAC --------- 5’ Primer Mse I
AATTCAAAC
GTTGTTA
AACCAAT
TTAAGTTTG
Corrida electroforética en gel de poliacrilamida
bajo condiciones denaturantes
Fuentes de polimorfismo:
Pérdida de sitios de restricción
In-dels
Ventajas
Más eficiente que RAPD
No requiere el diseño de partidores específicos
Permite el análisis de un alto número de loci en el genoma
Desventajas:
Diversidad alélica por locus reducida sólo a presencia
ausencia.
Marcador dominante no permite detectar heterocigotos
Requiere de ADN de alta calidad y pureza
Microsatelites
Secuencias simples repetidas en tandem a nivel del ADN
sin función conocida extremadamente variables
También conocidos como SSR (Simple Sequence
Repeats)
SSR Mononucleotídica (A)11
ctgttgAAAAAAAAAAAtgagag
SSR Dinucleotídica (GT)6
ccaagtGTGTGTGTGTGTtgaat
SSR Trinucleotídica (CTG)4
cagagtCTGCTGCTGCTGgtaat
SSR Tetranucleotídica (ACTC)4
actgtACTCACTCACTCACTCtgaat
Homocigotos:
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)7
Heterocigotos:
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTATCGGTACTACGTGG…
(CT)7
…CGTAGCCTTGCATCCTTCTCTCTCTCTCTCTCTCTATCGGTACTACGTGG… (CT)9
Los microsatelites son considerados como:
- DNA “basura”
- Fuente necesaria de diversidad genética
- Reguladores de la expresión y función de proteínas
Microsatelites (SSR)
Especímen A
Secuencia de
microsatelite
(CA)5 Alelo A
Especímen B
Secuencia de
microsatelite
(CA)3 Alelo B
Aplicaciones
Análisis forenses
Diagnóstico e identificación de enfermedades
Estudios demográficos
Estudios de estructura poblacional
Estudios en genética de la conservación
Determinación de stocks
Ventajas
Marcador codominante
Uso relativamente simple
En general son “neutros” al efecto de la selección natural
Alta presición en la determinación de alelos
Altamente variables
Muchos alelos por locus (polimórficos)
Desventajas
Requieren diseño de partidores especie-específicos (500.000 c/u)
Requieren de un secuenciador para el análisis de fragmentos
Dinámica evolutiva desconocida
Bandas stutter y alelos nulos complican su análisis
Exhiben significativos niveles de Homoplasia
Microarrays
Debido a:
1) Aumento en la secuenciación genómica de
distintas especies
2) Incremento en el conocimiento del
funcionamiento de los genes
Aparece una nueva técnica que analiza genes
funcionales, Microarrays (microarreglos)
Permite estimar el nivel de expresión de de
cientos de genes en una muestra
Microarray:
• Porta-objeto con una matriz de cientos de puntos
• Cada punto tiene secuencias de ADN el cual codifica para
un gen específico
Aplicación
• Mejor diagnóstico (ej. cancer) y
terapias
• Genes implicados en la
especiación
• Diferencia en la expresión de
genes en poblaciones diferentes
• Estudio de comunidades
bacterianas, microalgas, larvas
planctónicas
Desventajas
• Actualmente es extremadamente cara
($ 50.000 la placa)
• Se requiere diseñar el banco de genes:
tiempo y tecnología
• Por diferencias “entre-muestras”,
siempre es necesario poner dos muestras
juntas en una placa.
Usos potenciales de los distintos tipos de
marcadores en ecología, filogeografia y filogenia
Nivel
Jerarquico
Electroforesis
de proteinas
Secuencia
DNA/RNA
Secuenciación
DNA fingerprint
mtDNA, scnDNA, intrones,
RAPD, AFLP
Identidad
genética
Parentezco
Poblaciones
coespecíficas
Especies
relacionadas
Niveles
taxonómicos
intermedios
Separaciones
profundas
Adecuado, altamente informativo
Marginalmente informativo
No apropiado
Tomado de Sunnucks, 2000 TREE

similar documents