Chapter 17

Report
Chapter 17 - From Gene to Protein
Now that we know how the genetic design
information that codes for all the RNA/proteins
necessary to build/maintain organisms is
replicated so that it can be passed from cell to
cell, organism to organism or even virus to
virus…what is the next question?
Chapter 17 - From Gene to Protein
The next question concerns how DNA…
1. …is replicated during S phase so that the information it
encodes needed to build/maintain organisms can be passed to
the next generation.
2. …stores this information that will be used to make all the
RNA/polypeptides that will directly build/maintain the
organism.
molecular biology- the study of biology at the molecular level (overlaps biochemistry and
genetics in particular). Much of what we have done thus far is molecular biology – cell resp,
photosyn, membrane transport, endomembrane system, central dogma, etc… Mendelian
genetics is not because you never discuss the molecular level, but chromosomal genetics is.
Chapter 17 - From Gene to Protein
Your cells need “workers”. We have discussed many of
these workers in detail at this point: glycolysis enzymes,
krebs enzymes, ETC transporters, cytoskeleton,
antibodies, insulin, carbonic anhydrase, hemoglobin,
glucose transporter, Calvin enzymes, Photosystems,
kinesin, Various receptors, signal transduction proteins,
tRNA, ribosomes, photosystems, and the list goes on…
What determines the structure/function of a protein/RNA?
The sequence.
What determines the sequence?
The DNA (gene) sequence.
What determines your DNA sequence?
Your parents DNA sequence and the changes (mutations) that
might have occurred between them and you…
Chapter 17 - From Gene to Protein
NEW AIM: How is genetic information transmitted from DNA to protein?
How is the genetic
information
transmitted from DNA
to protein?
Fig. 10.6A
?
Chapter 17 - From Gene to Protein
NEW AIM: How is genetic information transmitted from DNA to protein?
What did we call
this process?
Fig. 10.6A
?
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
The Central
Dogma of
Molecular
Biology
Fig. 10.6A
?
What is the
first step
and what
enzyme is
involved?
Chapter 17 - From Gene to Protein
NEW AIM: How is genetic information transmitted from DNA to protein?
The Central Dogma of Molecular
Biology
By RNA polymerase
…and the
second
step?
Transcribe means to make a
written copy. mRNA is a copy
of a segment of DNA, a gene.
They are the same language –
nucleic acid language.
Chapter 17 - From Gene to Protein
NEW AIM: How is genetic information transmitted from DNA to protein?
The Central Dogma of Molecular
Biology
By the ribosome and tRNAs
Translate means to convert
between languages. In this
case, nucleic acid language is
translated into amino acid
language by the ribosome and
tRNA.
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
The Central Dogma
of Molecular Biology
Reminder (analogy):
The nucleus is the library, the DNA/chromosomes are the reference books that
cannot leave the library, and the mRNA is the transcription or copy of a small part of
the DNA, a gene, that is slipped through the nuclear pore to a ribosome (rRNA +
proteins) in the cytosol that will be involved in translating the nucleic acid language
into amino acid language (a polypeptide) with the help of tRNA.
Do bacteria have a library?
They do not have a nucleus…transcription occurs in the semifluid
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Fig. 10.7
Reminder:
A single chromosome has thousands of genes…
Each gene codes for?
A complementary piece of RNA (mRNA, tRNA or rRNA)
If the gene codes for mRNA, then the mRNA will code
for?A polypeptide
Quaternary
If the polypeptide is functional all by itself
(no __________
structure), it is a…?
Protein
Chapter 17 - From Gene to Protein
NEW AIM: How is genetic information transmitted from DNA to protein?
The Central Dogma of Molecular
Biology
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
1. TRANSCRIPTION (The Basics)
You be RNA polymerase and transcribe the above piece of
DNA…
Fig. 10.8B
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
1. TRANSCRIPTION (The Basics)
PROBLEM: DNA has two strands. RNA polymerase only
transcribes one strand into RNA… Which one?
- That depends on the gene. The same strand will
always be transcribed by RNA polymerase for a given
gene.
Fig. 10.8B
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
1. TRANSCRIPTION (The Basics)
3’
5’
5’
3’
In this example, it is the top strand that will be transcribed.
Transcribe it…
Fig. 10.8B
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
1. TRANSCRIPTION (The Basics)
3’
5’
SEEING DOUBLE:
RNA polymerase will bind to the DNA, open up the strands (using ATP of
course) and random RNA nucleotides (triphosphates) will bounce in and out
of the active site until the complementary one bounces in and sticks long
enough for the condensation reaction to occur forming a phosphodiester
linkage.
Which
DNA strand
doeslike
the the
transcribed
strand look
like? with U
The RNA
transcript
will look
non-transcribed
strand
5’
3’
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
1. TRANSCRIPTION (The Basics)
Template/antisense or non-coding stran
The transcribed strand is
also called the:
1. Template Strand
2. anti-sense strand
3. non-coding strand
Sense or coding strand
The reason for number one is
obvious, but the other two are
not...these are named this way
because:
The other DNA strand is called the:
1. Sense strand
2. Coding strand Why? Because the sequence of this strand matches
Fig. 10.8B
the RNA with U for T of course. Therefore, this DNA
strand makes sense because it matches the RNA.
Also, the RNA carries the CODE and therefore the
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
1. TRANSCRIPTION (The Basics)
3’
5’
Template/antisense or non-coding stran
RNA polymerase is similar
to DNA polymerase in that:
It can only synthesize RNA
from the 5’ to 3’ end…
How would you label the
DNA in this case?
You label the sense strand
the same way the RNA
transcript is labeled and the
complementary strand that
RNA polymerase used to
make the transcript must be
antiparallel…
5’
5’
3’
Sense or coding strand
3’
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question 1:
Write out the transcript of the following gene from 5’ to 3’ if the
top strand is the sense strand.
3’
5’
ATAGCGGCTATTA
3’
5’TATCGCCGATAAT
ANS: 5’
AUUAUCGGCGAUA
3’the template strand is the opposite
If the top strand is the sense strand then
strand or the bottom one. RNA polymerase can only make RNA 5’ to 3’ and
therefore must start on the right and work toward the left looking at the bottom
strand. You could also reason that the top is the sense and the transcript must
read just like the sense from 5’ to 3’.
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question 2:
Write out the transcript of the following gene from 5’ to 3’ if the
bottom strand is the antisense (non-coding) strand.
5’
3’
ATAGCGGCTATTA
5’
3’TATCGCCGATAAT
ANS: 5’
AUAGCGGCUAUUA3’
Since the bottom strand is the non-coding strand or antisense strand, this is the
template. RNA polymerase looks at this one and adds the complementary bases
starting at the 3’ end since it can only make RNA 5’ to 3’.
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question 3:
Write out the transcript of the following gene from 5’ to 3’ if the
bottom strand is the sense (coding) strand.
5’
3’
ATAGCGGCTATTA
5’
3’TATCGCCGATAAT
ANS: 5’
UAAUAGCCGCUAU
3’ (sense strand), the top one is the
Since the bottom strand is the coding strand
template. RNA polymerase looks at the top strand and adds the complementary
bases starting at the 3’ end since it can only make RNA 5’ to 3’.
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question 4:
RNA polymerase makes the following transcript:
RNA Transcript: 5’
AUCGCGGUUACGG
3’
Draw
out the piece of DNA corresponding
to this transcript:
3’
5’ ATCGCGGTTACGG
5’
3’ TAGCGCCAATGCC
You are given the transcript. There are a few ways to do this. I prefer thinking
from the perspective of RNA polymerase. Since this is what it made, it must have
looked at the complementary DNA strand going from 3’ to 5’, which I wrote as the
bottom strand here. I then filled in the complementary DNA strand above it to
complete the double stranded DNA molecule.
DNA is always written with the 5’ end of one strand on the top
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question 5:
RNA polymerase makes the following transcript:
RNA Transcript: 3’
AUCCGGCGAUUUCG
5’ to this transcript:
Draw
out the piece of DNA corresponding
RNA Transcript (flipped over):
GCUUUAGCGGCCUA 3’
5’
3’
5’ GCTTTAGCGGCCTA
5’
3’ CGAAATCGCCGGAT
I will always write out the RNA transcript from 5’ to 3’ because this is how it is made and that
is what makes sense to me. Then you finish it the same way as the previous one…
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question 6:
You send in a segment of a gene to the DNA sequencing facility.
They return the following sequence to you:
3’
5’ GCAACTTCGCCATTAG
This is the sense strand. What would the RNA transcript be?
RNA Transcript: 5’
GCAACUUCGCCAUUAG 3’
It would be the same as the sense strand with U substituted for T.
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION (the details)
What parts of your genome (DNA/chromosomes) do RNA
polymerases
Thetranscribe?
30,000+ Genes
How do the enzymes (RNA polymerases) “know” where
the genes start and where they stop???
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION (some details)
a single gene
We only need to look at how this works at a single gene
as the process is similar for all of them.
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION (some details)
Let’s put this into some realistic context. Let’s imagine we are in the nucleus
of a beta cell of your pancreas, which are the ones that secrete insulin when
your blood glucose levels get too high (>140mg/dl). They need to be ready at
any moment in case you drink a soda… and thus the gene is typically active
and insulin is being made and packed into vesicles via the endomembrane
system. The vesicles sit and wait for glucose to bind a receptor on the
membrane followed by signal transduction, which will trigger the vesicles to
fuse with the membrane and thus release the insulin into the blood. Let’s
watch the mRNA being transcribed for the insulin gene…
Fig. 10.9B
AIM: How is genetic information
transmitted from DNA to Protein?
(Transcription Unit)
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION
Basic Anatomy of a Gene:
1. The Promoter – a sequence of DNA that RNA
polymerase will bind (“stick”) to indirectly with the help
of other proteins called transcription factors in order to
begina.transcription
video).
In prokaryotes the(see
consensus
sequence is TATAAT and is called the
Pribnow
box
b. In eukaryotes
the consensus sequence is TATAAA and is called the
TATA box
2. The Transcription Unit – the part that is transcribed
into RNA (promoter and terminator are not transcribed)
3. The Terminator – sequence of DNA that will cause
RNA polymerase to stop and fall off the DNA
Fig. 10.9B
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION
Let’s watch a video to see how these parts of the gene,
RNA polymerase, a bunch of special protein called
transcription factors and of course…ATP, come
together to make transcription possible.
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION of the gene
has 3 general stages:
A. Initiation
i. RNA polymerase and general TFs
bind to promoter region
ii. DNA unwinds and transcription
begins (requires ATP)
iii. The Promoter sequence “tells”
RNA polymerase which strand of
DNA to transcribe
Fig. 10.9B
3’
5’
5’
3’
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION of the gene
has 3 general stages:
A. Initiation
iv. Transcription factors
- Additional proteins required for RNA
polymerase to start transcription.
- We have spoken many times about such
factors being phosphorylated in the
cytoplasm via signal transduction resulting
in their export into the nucleus.
ASIDE: ATP does NOT REDUCE anything, it
phosphorylates.
Fig. 10.9B
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION of the gene
has 3 general stages:
A. Initiation
More Detail:
Don’t memorize this level of detail
unless you have nothing else to
do. First email me though and I
will find you something else to
do.
Fig. 10.9B
AIM: How is genetic information
transmitted from DNA to Protein?
Fig. 10.9B
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION (3 stages)
B. Elongation
i. RNA polymerase polymerizes
complementary RNA nucleotides across
from the template/anti-sense/noncoding strand., which is always the
same in a gene and is determined by
the promoter. sense
strand
coding
strand
3’
5’
5’
3’
5’
anti-sense
strand
5’
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION (3 stages)
B. Elongation
ii. Just like DNA polymerase,
where does RNA polymerase get
the energy to link together RNA
nucleotides?
A. From the nucleotides
themselves: they are all
triphosphates (ATP, GTP, UTP,
CTP) and have a higher affinity
for each other than for the
they are attached
iii.diphosphate
Rate:
to…
~60 nucleotides per second
Fig. 10.9B
5’
AIM: How is genetic information
transmitted from DNA to Protein?
Central Dogma (DNA to polypeptide)
1. TRANSCRIPTION (3 stages)
C. Termination
i. RNA polymerase reaches a
sequence in the gene that causes
it to fall off, releasing the
completed RNA transcript.
Fig. 10.9B
NEW AIM: How is genetic information transmitted from DNA
to Protein?
RNA polymerase making RNA (the red strand)
AIM: How is genetic information transmitted from DNA to
Protein?
What might be the evolutionary advantage of having a
nucleus? After all, bacteria do not have nuclei and they
make RNA and polypeptides from their chromosome
similar to eukaryotes…
Part of the answer might lie in RNA PROCESSING
By separating the initial RNA transcript from the
ribosomes in the cytoplasm, “workers” are able to modify
the RNA in various ways…it is all about
compartmentalization…
AIM: How is genetic information transmitted from DNA to
Protein?
RNA PROCESSING (eukaryotes ONLY)
By separating the initial RNA transcript from the
ribosomes in the cytoplasm, “workers” are able to modify
the RNA in various ways…it is all about
compartmentalization…
1. Adding the 5’ cap and the poly A (adenosine) tail
NEW AIM: How is genetic information transmitted from DNA to Protein?
RNA Processing (eukaryotes) – the 5’ cap and poly A tail
NEW AIM: How is genetic information transmitted from DNA
to Protein?
7-methyl-guanosine CAP
AIM: How is genetic information transmitted from DNA to
Protein?
RNA PROCESSING (eukaryotes ONLY)
1. Adding the 5’ cap and the poly A
(adenosine)
FUNCTION? tail
A. Both appear to be required for nuclear export.
B. Both protect the mRNA from hydrolysis in the
cytoplasm by nucleases known as RNAses.
C. The cap and tail assist the ribosome to bind
2. RNA Splicing
NEW AIM: How is genetic information transmitted from DNA
to Protein?
2. RNA Splicing
More detailed Anatomy of a
Eukaryotic Gene:
i. - Transcription unit of
eukaryotes is broken into
exons and introns.
- The introns are named
because they are
“intervening” sequences.
- Both the exons and introns
are transcribed as shown,
but…
Fig. 10.10
NEW AIM: How is genetic information transmitted from DNA
to Protein?
2. RNA Splicing
ii. Introns are removed from
the mRNA and the exons are
SPLICED together by the
spliceosome.
-some = body
iii. Spliceosomes are RNA and
protein complexes…(what
other complex is composed of
RNA and protein, and is active
between DNA and protein in
the central dogma also
supporting the RNA
world
The
ribosome
hypothesis?)
Why do splicing???
Fig. 10.10
NEW AIM: How is genetic information transmitted from DNA
to Protein?
2. RNA Splicing
What is the spliceosome
composed of?
SnRNPs (“snurps”)
1. SnRNP = Small nuclear ribonucleoproteins
(Small RNA/protein complexes in the nucleus)
2. Composed of a core snRNA
molecule of ~150 nucleotides with
associated proteins
3. Assorted SnRNPs combine to form
the spliceosome
Aside: Ribozymes are true RNA
enzymes. Certain species have introns
that splice themselves out (catalyze
their own removal without help from a
spliceosome). These are ribozymes.
Chapter 18 - Genetics of Viruses and Bacteria
Questions
1. RNA polymerase binds to __________________,
which in turn bind to each other and the promoter in
order to begin transcription.
2. The eukaryotic promotor is known as the
_____________, while the prokaryotic promotor is the
_______________.
3. Transcribe the following gene segment and write out
the corresponding RNA sequence from 5’ to 3’:
ATGGCCGGCTATTAAGCGAC
4. Identify the three general components of any gene.
5. One function of the 5’cap and 3’ tail is to protect the
mRNA from _____________ in the cytosol.
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Let’s look at a little history first…
Beadle and Tatum (1941)
In 1941, American geneticists Beadle and Tatum
proposed the “one gene, one enzyme” hypothesis,
which states that each gene codes for an enzyme
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Beadle and Tatum (1941)
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Let’s look at a little history first…
The hypothesis was later modified to the “one gene,
one protein” hypothesis…
It was again modified to the “one gene, one
polypeptide” hypothesis… (you should know why)
Getting closer and closer to the truth, but even this
hypothesis is not always correct…
because of ALTERNATIVE SPLICING
AIM: How is genetic information transmitted from DNA to
Protein?
ALTERNATIVE SPLICING
Exons can be spliced together in different ways leading
to different proteins/polypeptides being formed from
the
gene…
Thissame
may be
one reason why splicing evolved – you can get
more than one polypeptide per gene (not all genes do this).
AIM: How is genetic information transmitted from DNA to
Protein?
Exon Shuffling
NEW AIM: How is genetic information transmitted from DNA to Protein?
RNA Splicing
NEW AIM: How is genetic information transmitted from DNA to Protein?
The Final Mature mRNA:
UTR – untranslated region (guess why it is called this?)
AIM: How is genetic information transmitted from DNA to
Protein?
Transcription and RNA Processing Summary
1. RNA pol binds near promoter with help of transcription factors. ATP
required to start transcription.
2. Transcription of the transcriptional unit begins. RNA pol moves along
and puts complementary RNA nucleotides across from bases of the
template/anti-sense/non-coding strand building the transcript from 5’ to
3’. Energy comes from the nucleotides themselves (they are NTPs –
nucleotide
= ATP, CTP,
GTP,
UTP) and falls off.
3. RNA pol triphosphates
reaches the terminator
DNA
sequence
4. A 5’ cap and poly A tail is added if it is mRNA (as opposed to tRNA
or rRNA)
5. Introns are spliced out and exons spliced together by the
spliceosome resulting in the mature mRNA.
6. mRNA leaves nucleus through nuclear pore
Reminder: Transcription is similar for prokaryotes and eukaryotes with the exception of where it
happens (in the nucleus in eukaryotes), but RNA processing happens in eukaryotes only
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Fig. 10.6A
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Translating DNA/RNA Language
Code
into amino acid language)
Genetic Code:
The rules by which information is
encoded in DNA/mRNA and
translated into polypeptide
sequences.
The chromosomes are books,
which would make a gene just
one sentence in these books…
Chromosomes = Books
Gene = Sentence in the Book
RNA = A copy of the sentence
5’
What does the “sentence” say?
3’
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Translating DNA/RNA Language
Code
into amino acid language)
All English books are written
using 26 letters arranged into
different combinations to make
words, which are combined to
make sentences...
RNA Nucleic Acid Language is
MUCH simpler…
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Translating DNA/RNA Language
Code
into amino acid language)
RNA Nucleic Acid Language is
MUCH simpler…
1. There are only 4 letters
(A,U,G,C)
2. These letters combine to make
“words”, called codons, which are
only 3 letters long.
5’
3’
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Translating DNA/RNA Language
Code
into amino acid language)
RNA Nucleic Acid Language is
MUCH simpler…
1. There are only 4 letters
(A,U,G,C)
2. These letters combine to make
“words”, called codons, which are
only 3 letters long.
How many different codons can be
made from the four letters?
4 x 4 x4 = 64
5’
3’
*Only 64 words in the entire
language!!
(It could not be any simpler and still work)
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Deciphering DNA/RNA
Code
Language)
What do these 64 codons code
for?
1. Sixty-One of the codons code
for an amino acid
5’
3’
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Deciphering DNA/RNA
Code
Language)
What do these 64 codons code
for?
1. Sixty-One of the codons code
for an amino acid
Example:
The codon AUG codes for the
amino acid Methionine (Met) –
this is typically the first or starting
codon, whichMethionine
makes
__________ the first amino acid
of most proteins
5’
3’
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Cracking the Genetic
(Deciphering DNA/RNA
Code
Language)
What do these 64 codons code
for?
1. Sixty-One of the codons code
for an amino acid
This is not the actual start of the
mRNA, just the start of the
transcription unit (TU)
This is not the
actual end of the
mRNA, just the
end of the TU
Example:
The codon AUG codes for the
amino acid Methionine (Met) –
this is typically the first or starting 5’
codon, whichMethionine
makes
__________ the first amino acid
Label the two
of most proteins
ends of this
2. Three of the codons tell
polypeptide:
the ribosome to stop –
C
N
UAG, UAA, UGA
In reality, genes are thousands of bases pairs long as are mature mRNA’s
leading to polypeptides that range from 50 to 1000’s of amino acids
3’
NEW AIM: How is genetic information transmitted from DNA
to Protein?
The genetic code was
cracked in the 1960’s, just
after the structure of DNA
was elucidated.
The chart to the right is used to
look up any RNA codon and
determine the amino acid it codes
for…
Fig. 10.8A
The Genetic Code
NEW AIM: How is genetic information transmitted from DNA
to Protein?
There are Sixty-One codons
coding for amino acids, but
there are only how many
amino acids?
20
What does that mean?
Some amino acids are coded
for by more than one codon
like Leu, which is coded for by
6 codons (built in
redundancy)!
Fig. 10.8A
The Genetic Code
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question:
Translate the mRNA sequence below -
5’ GCGGGCAUAAUCGCAUGCCAUUUACGGGCAACUACUUUAAGCGGUAGU
STEP1: Find the first AUG (start codon). This is LIKELY the start of the coding r
5’ GCGGGCAUAAUCGCAUGCCAUUUACGGGCAACUACUUUAAGCGGUAGU
STEP2: Break it into codons if you like after the AUG…
5’ GCGGGCAUAAUCGC-AUG-CCA-UUU-ACG-GGC-AAC-UAC-UUU-AAG-CGG-UAG-UUU-
STEP3: Use the genetic code and translate it…
Met-Pro-Phe-Thr-Gly-Asn-Tyr-Phe-Lys-Arg
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question:
What is the mRNA sequence for the following polypeptide?
Met-Pro-Leu-Leu-Gly-Asn-Asp-Gly-Gly
You cannot know for sure since many of these amino acids
can be coded for by more than one codon…
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question:
A protein is 100 amino acids long. What would be the number
of nucleotides in a mRNA coding region needed to code for all
these amino acids?
303 base pairs
(3 per amino acid and 3 for a stop)
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Translation (mRNA to polypeptide) – the details
AIM: How is genetic information transmitted from DNA to
Protein?
5’
3’
Fig. 10.11B
Let’s start with tRNA
1. tRNA carries amino acids to the ribosome
2. Each of the 20 amino acids is carried by a DIFFERENT tRNA
3. The anticodon of the tRNA complementary basepairs with the codon of th
NEW AIM: How is genetic information transmitted from DNA
to Protein?
How are the amino acids added
to tRNA molecules?
Aminoacyl-tRNA synthetases (blue)
1. Enzymes that load the
correct amino acid on the
correct tRNA
2. Requires ATP (endergonic)
tRNA’s are loaded like loading
a gun. The amino acid wants to
“shoot off” the tRNA (similar to
the phosphate of ATP wanting
to shoot off).
Where will it be allowed to
To an amino acid in a growing
“shoot off”
to?
polypeptide chain within the ribosome.
Let’s see how this works…
NEW AIM: How is genetic information transmitted from DNA
to Protein?
How are the amino acids added
to tRNA molecules?
Aminoacyl-tRNA synthetases (blue)
1. Specific amino acid like
methionine, and ATP bind active
site.
2. ATP loses pyrophosphate and binds
to amino acid as AMP – known as
adenylation (amino acid now has
energy – wants to jump off).
3. Appropriate tRNA enters active site
–anticodon specifically binds to
enzyme.
4. Amino acid transfers from AMP to
tRNA forming aa-tRNA (aminoacyltRNA).
It still has energy as the tRNA has a low
affinity for the amino acid, just higher than
AMP.
NEW AIM: How is genetic information transmitted from DNA
to Protein?
How many different aa-tRNA
synthetases are there?
20, one type for each amino acid…
(With confused look on face):
Hold up, there are 61 amino
acid coding codons though and
therefore 61 different tRNA’s!!
How are there only 20
synthetases?
These enzymes have evolved
to be able to bind more than
one type of tRNA…
Let me really blow your mind…
There are only ~45 different tRNA’s.
Some can recognize more than one codon…the wobble
base pair as proposed by Crick in 1966.
I thought only weebles wabble!
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Inosine??? What’s an
inosine???
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Inosine
(a purine)
And you thought there were only 4
different bases in RNA…lol!!
NEW AIM: How is genetic information transmitted from DNA
to Protein?
?
Which amino acid will
be added to this
tRNA?
ALWAYS Alanine
(Ala)
NEW
AIM:17
How
is genetic
Chapter
- From
Geneinformation
to Proteintransmitted from DNA
to Protein?
AIM: How is genetic information transmitted from DNA to protein?
Identify the amino acid found on a tRNA
with the anticodon 3’-GCC-5’.
1. The codon on the mRNA would be 5’CGG-3’
2. Look this codon up
3. The amino acid attached to this tRNA if Arginine (Arg)
The amino acid proline is bound to a tRNA. What could the
anticodon of this tRNA be?
The codons for proline (5’ to 3’) are: CCU, CCC, CCA and CCG
The anticodon (3’ to 5’) could then be: GGA, GGG, GGU or GGC
NEW AIM: How is genetic information transmitted from DNA
to Protein?
5’
3’
5’
C
U
A
3’
Which amino acid will be added
to this tRNA (careful)?
Aspartate (Asp)
Remember that the mRNA is read 5’ to 3’ by the
ribosomes. Therefore the tRNA will bind antiparallel 3’
CUA 5’ and the codon will be 5’ GAU 3’.
AIM: How is genetic information transmitted from DNA to
Protein?
Fig. 10.13A
Translation (the details):
Broken up into 3 stages just like transcription
1. Initiation
2. Elongation
3. Termination
It all begins when the mRNA leaves the nucleus and is in the
AIM: How is genetic information transmitted from DNA to
Protein?
STAGE 1: Initiation
1. The small subunit of the ribosome binds to a specific nucleotide sequence in the mRNA
upstream of the start codon with the help of the cap. It will make its way to the start codon
(AUG). The initiator tRNA (the first or starting tRNA) carrying methionine.
2. The initiator tRNA (the first or starting tRNA) carrying methionine then binds via complementary base
pairing rules.
3. The large subunit of the ribosome then binds placing the initiator tRNA in the P site (you
can think of P for polypeptide site).
Other proteins known as initiator factors are required along with GTP for initiation to occur,
but not shown here…coming soon.
AIM: How is genetic information transmitted from DNA to
Protein?
1
N
STAGE 2: Elongation
1. Codon Recognition: The next
tRNA enters the A site. A stands
for amino acid as this is the site
where amino acids attached to
tRNA’s enter the ribosome.
2. Peptide bond formation: The
ribosome catalyzes the transfer of
the polypeptide (or amino acid if
this is the second codon) to the
amino acid in the A site resulting in
the formation of a peptide.
3. Translocation: The RIBOSOME
ONLY moves to the right
(translocates) one codon. The P
site tRNA enters the E (exit) site
and falls out. The A site tRNA
enters the P site. The A site is now
open and ready for the next amino
N
N
N
3
2
Fig. 10.14
AIM: How is genetic information transmitted from DNA to
Protein?
QUESTION:
The ribosome is translocating
along the mRNA. What is the next
step?
The polypeptide will be transferred to
the amino acid in the A-site resulting in
the formation of a peptide bond.
Fig. 10.12C
AIM: How is genetic information transmitted from DNA to
Protein?
A more realistic view of what
elongation looks like:
Fig. 10.12A
AIM: How is genetic information transmitted from DNA to
Protein?
STAGE 3: Termination
- When the ribosome arrives at a stop codon, a protein called release
factor (NOT a tRNA) binds to it and causes the ribosome to break off,
releasing the polypeptide.
AIM: How is genetic information transmitted from DNA to
Protein?
STAGE 3: Termination
- When the ribosome arrives at a stop codon, a protein called release
factor (NOT a tRNA) binds to it and causes the ribosome to break off,
releasing the polypeptide.
NEW AIM: How is genetic information transmitted from DNA
to Protein?
Translation (mRNA to protein)
AIM: How is genetic information
transmitted from DNA to Protein?
OVERVIEW
This is it! This is how every
RNA/polypeptide in all of
your cells is made starting
from the gene!!
The ribosome does not
translate the mRNA, what
tRNA, the ribosome allows for stable
does?
tRNA binding and catalyzes the
subsequent dehydration reaction leading
to peptide bond formation.
Fig. 10.15
AIM: How is genetic information transmitted from DNA to Protein?
DNA to mRNA to polypeptide (the entire dogma)
AIM: How is genetic information
transmitted from DNA to Protein?
Polyribosomes
Many ribosomes can ride along a
single piece of mRNA at the same
time as shown to the right.
Observed in both prokaryotes and
eukaryotes
Fig. 10.15
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Question:
Write out the polypeptide sequence for the following gene
fragment if the top strand is the sense strand (assume no
splicing).
3’
5’
CCGCGATTTAGCGGCTATTA
5’ GGCGCTAAATCGCCGATAAT
3’
CGCTTGTACG
The mRNA:
5’
GCGAACATGC
GCAUGUUCGCAUUAUCGGCGAUUUAGCGCC
3’
Find the reading frame:
The mRNA: 5’ GC-AUG-UUC-GCA-UUA-UCG-GCG-AUUUAG-CGC-C 3’
The polypeptide: (N) Met-Ala-Ala-Leu-Ser-AlaIle (C)
AIM: How is genetic information
transmitted from DNA to Protein?
How are proteins targeted to specific locations like outside
the cell or into the ER, Golgi, Lysosome, etc…?
(Endomembrane system revisited)
This figures shows the how a polypeptide destined to one of the places mentioned above gets
access to the ER by having a signal peptide (ER localization signal), with the help of an SRP (a
protein + RNA complex) and SRP receptor on the ER. Make sure you know the rest of the story for
AIM: How is genetic information
transmitted from DNA to Protein?
RNA Review
Review
Chapter 17 - From Gene to Protein
AIM: How is genetic information transmitted from DNA to protein?
Comparing prokaryotic and eukaryotic gene transcription:
Unlike in eukaryotes because
of the nucleus, prokaryotes
can translate while the RNA
polymerase is still transcribing
the gene!!
Chapter 18 - Genetics of Viruses and Bacteria
Questions
1. A point mutation that changes one codon to another,
but the amino acid being coded for remains the same.
2. A chemical compound that could potentially cause
cancer.
3. Give an example of a spontaneous mutation.
4. Example of a virus that can potentially cause cancer.
5. A mutation that leads to the formation of a stop
codon.
6. Describe a specific mutation that would result in a
reading frame shift.
Chapter 17 - From Gene to Protein
NEW AIM: How are genes altered and what is the result?
Mutagenes
is
Muta- = mutation = any change in the sequence of DNA
-genesis = origin or production of
Therefore, mutagenesis means to “Produce a
mutation” or to produce any change in the DNA
sequence of an organism.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
What causes mutations?
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Spontane
ous vs
Induced
Mutations
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Spontaneous
- Those that occur as a result of natural cell
mutations
processes like:
1. Copying errors by DNA polymerase
during cell cycle or meiosis
2. Errors in DNA repair
3. Errors in recombination (crossing over)
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced
1. Mutations caused by the interactions
mutations
of DNA with an an outside agent or
mutagen
Mutagens can be:
a. High energy radiation
-electromagnetic
-gamma rays, X-rays, UV rays
-Nuclear radiation
-Ex. Alpha particles
b. chemical
c. virus
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Carcinogen
- Prefix carcino- = cancer
Ex. Carcinoma – cancer starting from epithelial cell
- A carcinogen is a cancer causing agent
Recall: How does cancer arise?
Cancer results from mutations in specific genes that are
involved in controlling the cell cycle (G1 checkpoints).
**Therefore, almost all mutagens are also
carcinogens since mutagens cause mutations,
which can potentially cause cancer.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
1. High energy radiation
a. 80 % from natural sources (called background
radiation)
Electromagnetic
radiation
(light; photons)
Nuclear Radiation
(unstable ratio of
Protons to neutrons)
- UV light from the sun causing thymine dimers,
etc…
- gamma rays from outside Earth (ex. Distant supern
- Soil and certain rocks in the Earth’s crust conta
radioactive radon gas
This can be problematic in the basements of homes as the
radon gas seeps into the basement and is inhaled by the
occupants. Living on Long Island, we rarely have this problem
as the island was deposited by a glacier.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
1. High energy radiation
b. 20% from man-made sources
-color TV, smoke detectors,
computer monitors, X-ray
machines, nuclear plants, etc…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
1. High energy radiation
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
1. High energy radiation
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
2. Chemicals
A. Industrial chemicals
Ex.
-used to make plastics, but…
Acrylamide
-occurs in many cooked starchy foods.
-discovered in starchy foods, such as potato chips, French
fries and bread that had been heated.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
2. Chemicals
B. Pollutants
Ex. Cigarette Smoke
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
A List of known carcinogens in cigarette smoke
Acetaldehyde
Acetamide
Acrylamide
Acrylonitrile
2-Amino-3,4-dimethyl-3H-imidazo[4,5-f]quinoline (MeIQ)
3-Amino-1,4-dimethyl-5H-pyrido [4,3-b]indole (Trp-P-1)
2-Amino-l-methyl-6-phenyl-1H-imidazo [4,5-b]pyridine (PhlP)
2-Amino-6-methyldipyrido[1,2-a:3',2'-d]imidazole (Glu-P-1)
3-Amino-l-methyl-5H-pyrido {4,3-b]indole (Trp-P-2
2-Amino-3-methyl-9H-pyrido[2,3-b]indole (MeAaC)
2-Amino-9H-pyrido[2,3-b]indole (AaC)
4-Aminobiphenyl
2-Aminodipyrido[1,2-a:3',2'-d]imidazole (Glu-P-2)
0-Anisidine
Arsenic
Benz[a]anthracene
Benzene
Benzo[a]pyrene
Benzo[b]fluoranthene
Benzo[j]fluoranthene
Benzo[k]fluoranthene
Benzo[b]furan
Beryllium
1,3-Butadiene
Cadmium
Catechol (1,2-benzenediol)
p-Chloroaniline
Chloroform
Cobalt
p,p'-DDT
Dibenz[a,h]acridine
Dibenz[a,j]acridine
Dibenz(a,h)anthracene
7H-Dibenzo[c,g]carbazole
Dibenzo(a,e)pyrene
Dibenzo(a,i)pyrene
Dibenzo(a,h)pyrene
Dibenzo(a,i)pyrene
Dibenzo(a,l)pyrene
3,4-Dihydroxycinnamic acid (caffeic acid)
Ethylbenzene
Ethylene oxide
Formaldehyde
Furan
Glycidol
Heptachlor
Hydrazine
Indeno[1,2,3-cd]pyrene
IQ 92-Amino-3-methyl-3H-imidazo[4,5-f]quinoline)
Isoprene
Lead
5-Methyl-chrysene
2-Naphthylamine
Nitrobenzene
Nitrogen mustard
Nitromethane
2-Nitropropane
N-Nitrosodi-n-butylamine (NDBA)
N-Nitrosodi-n-propylamine (NDPA)
N-Nitrosodiethanolamine (NDELA)
N-Nitrosodiethylamine (DEN)
N-Nitrosodimethylamine (DMN)
N-Nitrosoethylmethylamine (NEMA, MEN)
4-(N-Nitrosomethylamino)-1-(3-pyridinyl)-1-butanone (NNK)
N'-Nitrosonornicotine (NNN)
N-Nitrosopiperidine (NPIP, NPP)
N-Nitrosopyrrolidine (NPYR, NPY)
Polonium-210 (Radon 222)
Propylene oxide
Safrole
Styrene
Tetrachloroethylene
o-Toluidine (2-methylaniline)
Trichloroethylene
Urethane (carbamic acid, ethyl ester)
Vinyl acetate
Vinyl chloride
4-Vinylcyclohexene
2,6-Xylidine (2,6-dimethylaniline)
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Benzo[a]pyrene
This is what happens to the DNA in your
lungs when you suck in benzo[a]pyrene.
Then when the cell divides and DNA
polymerase tries to copy this DNA, a
random base will be inserted causing a
mutation.
Benzo[a]pyrene DNA adduct
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
2. Chemicals
D. Food Additives
i. Acesulfame K
ii. Artificial coloring (blue-1, blue-2, red-3, yellow6)
iii. BHA and BHT
iv. Nitrite and Nitrate
v. Olestra
vi. Potassium Bromate
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Induced mutations
A. Mutagens (carcinogens)
5. Certain drugs
Ex. Chemotherapy drugs
6. Viruses (Oncoviruses)
a. HPV (Human Papilloma Virus)
b. EBV (Epstein Barr Virus)
c. Hepatitis C virus
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Types of Mutations that can oc
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
1. Point (substitution) mutations:
Wild type
A
mRNA
G
U
A A G U U U G G C U A A
5
Protein
3
Lys
Met
Phe
Gly
Amino end
Stop
Carboxyl end
Base-pair substitution
No effect on amino acid sequence
U instead of C
Silent point mutation
A
U G
A
(amino acid remains same)
A G U
Lys
Met
Phe
Missense
Missense point mutation
A
G U U
Gly
A
A
Stop
A instead of G
U G
(amino acid changes to a different amino acid)
U U G
A
A
G U
Lys
Met
U U
Phe
A G U U
Ser
A
A
Stop
Nonsense
U instead of A
Nonsense point mutation
(amino acid codon changes to a stop codon)
A
U G U
Met
Fig. 10.16A
A G U U
Stop
U
G G C U
A
A
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
1. Point (substitution) mutations:
Sickle cell anemia is caused by a point mutation in the
hemoglobin gene creating the sickle cell allele.
Fig. 10.16A
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Fig. 10.16B
Reading Frames
-All mRNAs have three possible reading frames as shown above.
-The actual reading frame is determined by the promoter and start codon of the
mRNA.
- A mutation can cause a change in the reading frame…see previous slide.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
2. Insertions and deletions
Wild type
A
mRNA
A
G
U
A
G
U
U
G
U
G
C
U
A
A
3
5
Met
Protein
Lys
Gly
Phe
Amino end
Stop
Carboxyl end
Base-pair insertion or deletion
Frameshift causing immediate nonsense
Extra U
Inserting/deleting nucleotides
can shift the reading frame
(every codon from the
insertion/deletion onward will
change) changing every amino
acid and possible create a stop
codon (very severe mutation)…
Deleting or inserting triplets IN
FRAME (no frame shift results)
will simply remove or add amino
acids to the polypeptide (not as
severe a mutation as one that
causes a frame shift obviously).
A
G
U
A
U
Met
A G
U
G
G C
U
A
A
Missing
U
G
U
U
Stop
Frameshift causing
extensive missense
A
U
A
A
Met
G
U
Lys
U
G
G
C
U
Ala
Leu
Insertion or deletion of 3 nucleotides:
no frameshift but extra or missing amino acid
A
A
U
Met
A
G
Missing
G
U
U
Phe
U
G
G
Gly
C
U
A
Stop
A
A
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Cause of Tay Sach’s
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Types of Mutations
1. Point mutants or substitutions
2. Deletion
3. Insertion
4. Duplication
5. Inversion
6. Translocation
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Somatic
vs
Germline mutations
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Somatic mutations
Mutations occurring in body cells that can lead
to cancer, but are not heritable (can be passed
to offspring).
Is cancer itself heritable?
Cancer is NOT heritable, but the predisposition to get
cancer IS!
Ex. You can inherit mutations in genes that code
for DNA repair proteins causing these proteins not
to work. Therefore, when you get mutations in life,
you are not able to fix them as well as someone
without the mutations and you are more likely to
-The famous
case
are the BRCA1
and BRCA2 alleles which code for DNA repair
get
cancer
sooner…
enzymes. (BRCA = breast cancer) Women with either of these mutated alleles are
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Germline mutations
Germline cells
- gametes and the cells that will become gametes after
meiosis.
How are these mutations different?
Mutations that occur in these cells can be
inherited by the offspring. These are the critical
ones in terms of evolution.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
?
or
Are mutations positive
Negative for the organism
The majority of mutations tend to be negative
(~70% of the time), the remainder are typically
neutral (no effect) and in rare cases beneficial.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Somatic cells – negative mutations:
- If it is a somatic mutation and causes cancer then obviously it
is negative (reduces one’s ability to survive/reproduce).
- Random mutations (second law of thermodynamics) in your 1
trillion somatic cells accumulate over time causing proteins to
most likely function less efficiently. This can lead to further
mutations as well as the characteristics of aging.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Somatic cells – negative mutations:
Can a somatic mutation cause a disease like Huntington’s?
No, because the mutation happens in only one cell and is not
inherited. It would need to be in all cells and that is highly
unlikely to ever happen…
Can a person with Huntington’s get mutations such that the
diseased allele is mutated back to the normal allele and be
cured?
Is it possible?…I guess it is, but every cell affected by the
mutation (tens of millions) would all need to mutate back to the
normal allele…I don’t think so…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Somatic cells – neutral mutations:
A good number of mutations are neutral – they have no effect on the
organism like the silent mutation or mutations in “junk” DNA or
mutations that change amino acids that do not change the function of
the protein…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Somatic cells – positive mutations:
It is rare to observe a positive mutation in a somatic cell since it is only
one cell out of 1 trillion. You will likely never see it.
However, cancerous cells, which are your somatic cells gone rogue,
can have positive mutations allowing them to move more easily and
divide more readily. Although this is not positive for the organism, it is
temporarily positive for the cancer cells in terms of reproduction…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Germline cells – negative mutations:
1. The mutation is Negative if the offspring has a reduced
ability to survive and reproduce in the current environment.
A. Why do I say “current environment”?
i. Because a mutation can be negative in one
environment, but positive in another like the sickle cell
allele (negative in US, but positive in Africa).
Ex. Mutation that generated the Huntington’s disease allele,
mutations in DNA repair genes that predispose the individual to
cancer (BRCA-1 allele), or perhaps a mutation that reduced the
efficiency of ATP production…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Germline cells:
Neutral mutations, similar to somatic neutral mutations, have
no positive or negative effect on the organism that is obvious.
Ex. Silent Mutations, mutations in “junk” DNA, mutation
that changes your fingerprint, etc…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Positive/Negative/Neutral
Germline cells – positive mutations:
Positive if the offspring has a ENHANCED ability to
survive/reproduce in the current environment.
Ex. Mutation in hemoglobin resulting in the sickle cell allele
in Africa, mutation that resulting in the generation of the
blue eye allele in northern Europe (advantage may be
better vision in the lower light conditions), mutation that
generated the allele in certain humans that confers
resistance to HIV…
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
What do all these germline
mutations have in common whether
positive or negative?
Mutations Randomly Create New
Alleles
Without mutation, there would be no new alleles,
organisms would never change (no evolution!). Why would
this
not be good?
Because
the environment changes over time, and if
organisms cannot change to keep up with it there will be
no organisms.
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Mutations are the Creative Force behind
The creative force behind evolution is
evolution!!
Creative Force behind evolution =
mutation!!
mutation.
Mutation = Creative Force behind
evolution
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Mutations are the Creative Force
behind evolution!!
Nature is a selective force, an allele
“filter” only letting some of these
randomly generated alleles survive
and make it to the next generation!
Chapter 17 - From Gene to Protein
AIM: How are genes altered and what is the result?
Mutations can be a tool for
scientists…
Ex. You have determined the structure of an enzyme and
you now want to know which amino acids are important for
catalyzing the reaction.
How could you determine
this?
1. Mutate the gene to
change the amino acid to
glycine, which doesn’t
have
sideenzyme.
chain.
2. Testa the
3. If it still works then the side
chain is not important. If it
doesn’t work, the side chain

similar documents