Infection à C.trachomatis et mycoplasmes uro-génitaux en

Report
Infection à C.trachomatis et
mycoplasmes uro-génitaux en 2011:
recommandations diagnostiques et
thérapeutiques.
Bertille de Barbeyrac
Université Bordeaux Segalen, INRA,
USC Infections Humaines à mycoplasmes et à chlamydiae,
Centre National de Référence des infections à chlamydiae,
Bordeaux, France
COREVIH – Santé sexuelle et infection à VIH- Lyon - 4 novembre 2011
Chlamydia trachomatis
Infection à C. trachomatis
• Infection commune
• Asymptomatique (50% H, 90% F)
• Complications : salpingite, stérilité, GEU,
transmission HIV facilitée, persistance HPV?
• Curable
• Facile à diagnostiquer
En France
• Population infectée (3,2% des 19-30 ans)
– [71 000 – 203 000] cas
• Nombre de FIV : 45 000
– Origine tubaire 40%
– due à C. trachomatis (50% des indications
tubaires) : 9000 cas
• 3000 cas GEU due à C. trachomatis
Infections humaines à C. trachomatis
Problèmes de santé publique et d’actualité


A-C
D-K
Trachome
Infections
Sexuellement
Transmises
L1-L3
LGV
Dépistage : qui? et comment?
données épidémiologiques disponibles en France
● Réseau de laboratoires sentinelles : Rénachla
● Enquêtes sur populations cibles
- facteurs de risque:
âge < 25 ans F
< 30 ans H
partenaires multiples…
- centres à vocation dépistage: CDAG, CIDDIST
planning familial, IVG
- en Médecine préventive
● Enquête sur la population générale
Dépistage : qui? et comment?
 Femmes < 25 ans et les hommes < 30 ans
 toutes dans les centres à vocation dépistage
(CDAG/CPEF/orthogénie)
 + 1 facteur de risque en population générale
● auto-prélèvements
- 1er jet d’urine chez l’homme
- auto-écouvillonnage chez la femme
 Par PCR (JO 2011 05 10) : code 5257 Recherche d’ADN ou d’ARN de
Chlamydia trachomatis par amplification génique in vitro sur tout
type d’échantillons à partir de sites possiblement infectés : B 85.
Facteurs de risque identifiés
Age
25-29 (2,7%)
18-24 (3,6%)
Niveau d’éducation
élevé (1%)
bas (12,5%)
Orientation sexuelle
hétero (2,6%)
homo-bi (13%)
Nbre de partenaires
0-1 (2,4%)
 2 (13,1%)
Dernier partenaire
principal (2%)
nouveau (8,4%)
C. trachomatis, M. genitalium et N. gonorrhoeae
Chez la femme enceinte (PHRC MATIST)
Age
Nombre
CT %
MG %
NG %
18-44
1006
2,5
0,8
0
18-24
166
7,9
2,4
0
25-29
317
1,3
0,6
0
 30
523
1,5
0,4
0
Notice explicative « Femme » (1)
Notice explicative « Femme » (2)
Dépistage : qui? et comment?
 Femmes < 25 ans et les hommes < 30 ans
 toutes dans les centres à vocation dépistage
(CDAG/CPEF/orthogénie)
 + 1 facteur de risque en population générale
● auto-prélèvements
- 1er jet d’urine chez l’homme
- auto-écouvillonnage chez la femme
 Par PCR (JO 2011 05 10) : code 5257 Recherche d’ADN ou d’ARN de
Chlamydia trachomatis par amplification génique in vitro sur tout
type d’échantillons à partir de sites possiblement infectés : B 85.
Modification de la nomenclature
 Suppression des actes
5254 : recherche directe par méthode immunologie
5255 : recherche par culture
5256 : recherche d’ADN ou d’ARN par hybridation
moléculaire
 Reformulation de l’acte 5257
Recherche d’ADN ou d’ARN par amplification génique in vitro
sur tout type d’échantillons à partir de sites
possiblement infectés
Une seule cotation par patient
B85
TAANs (tests d’amplification des acides
nucléiques) en France
• Automates : extraction-amplification (CT/NG)
– Multi-tests (Roche, Abbott, Gen-Probe, BD, Siemens)
– Test unitaire (GenExpert)
• Trousse sur amplificateur fermé: Bio-Rad
(CT/NG/MG)
• Trousses (amorces+sondes) : Diagénode, Argène,
Quiagen….adaptables sur amplificateur ouvert
(PCR en temps réel)
• Seegene : PCR en point final avec lecture sur gel
(6 ou 7 micro-organismes)
Choix des TAANs
•
•
•
•
De plus en plus ouvert
Des performances comparables
Des cadences adaptables
Un nombre croissant de micro-organismes
détectables: CT, CT/NG, CT/NG/MG,
CT/NG/MG/TV et des virus, herpes, HPV….
Lymphogranulomatose vénérienne (L1-L3)
Anorectite
Aigüe:
Tenesme,
douleur,
Pus, diarrhée  ulcération(s) ano-génitale
Adénite
inguinale
 Epidémie de LGV rectale en Europe
C. trachomatis L2b
 Recommandation : si pvt rectal + : génotypage CNR
LGV
- Endémique Afrique, Asie, Amérique du Sud, Caraïbes
- Exceptionnelle en Europe (cas importés)
- Avril 2004 : Alerte Européenne grâce au Système Européen de
Surveillance des IST (ESSTI)
●
●
●
●
13 cas de LGV rectales serovar L2, Rotterdam- Eté 2003
Homosexuels masculins, 26-45 ans
11VIH+, 6/13 IST concomittante
Rapport anaux non protégés avec des partenaires anonymes dans plusieurs
pays européens dont la France
● Information des partenaires (réseaux, CNR)
surveillance prospective
•
•
cas suspect : rectite symptomatique chez un homme
cas confirmé : échantillon ano-rectal PCR +
génotype L2 (L2b)
3 Laboratoires
parisiens
Echantillon PCR CT +
CNR Bordeaux
/ trimestre
Statut VIH
genotypage
InVS
Génotypage omp1 de Chlamydia trachomatis
Echantillon rectal PCR +
1) extraction
2) PCR ciblée gène omp1fragment 1100pb
3) hydrolyse de restriction (AluI et triple hydrolyse HinfI, HpaII, EcoRI)
et analyse sur gel de polyacrylamide
4) séquençage L2b
Identification des souches L2b
Séquençage du domaine variable V2:
mise en évidence d’une mutation ponctuelle AA 162
L2 
AAT 
Asp 
L2b
AGT
Ser
Surveillance prospective
45
20
18
16
14
12
10
8
6
4
2
0
80
A
M
J
J
A
S
O
N
D
J
F
M
A
M
J
J
A
S
O
N
D
J
F
M
A
M
J
J
A
S
O
N
D
Alerte
2002
2003
125 cas
Durée moyenne des symptomes: 15 jours
2004
Situation Epidémiologique en Europe
Pays-Bas: 144 cas
France : 243 cas
UK: 34 cas
Belgique: 27 cas
Allemagne: 20 cas
Suède: 3 cas
Espagne: 2 cas
5
2005
Evolution du nombre d'infection rectale à
C. trachomatis entre 2002 et 2010
LGV 1086 cas
Nbre de cas
300
282
non L
L2
250
Non L 494 cas
171
200
210
246
287
227
128
150
100
50
0
6
2002
23
2003
2004
2005
2006
2007
2008
2009
2010
Répartition en France
LGV/ non LGV (902/391 cas)
2002-2009
Brest
0/1 

Caen
0/1

Nantes
0/1
Lille /Tourcoing
 21/32

Amiens
1

Paris
781/291


0/1
Dijon
Blois
0/1

Bordeaux
25/14 
Toulouse
0/3

Strasbourg
5/0

Mulhouse
1/2

Lyon
16/6
Nîmes
Montpellier

2/3

Marseille
2/3
Mise en place d’un réseau de surveillance en 2010 :
recueil de données cliniques, comportementales et
biologiques
Détection spécifique des souches L
cible pmp H des souches L : délétion 36 bases/98
PCR en sonde Taqman
D/UW-3/ GGGAAAACCGTGAGTATTTCCGGAGCAGGCGAAGTGATTTTTTGGGATAA
L2/434 GGGAAAACCGTGAGTATTTCCGGAGCAGGCGAAGTGATTTTCTGGGATAA
***************************************** ********
D/UW-3/ CTCTGTGGGGTATTCTCCTTTGTCTATTGTGCCAGCATCGACTCCAACTC
L2/434 CTCCGTGGGGTATTCTCCTTTATCTACTGTGCCAACCTCATCATCAACTC
*** ***************** **** ******* * ** * ******
D/UW-3/ CTCCAGCACCAGCACCAGCTCCTGCTGCTTCAAGCTCTTTATCTCCAACA
L2/434 CGCCTGC------------------------------------TCCAACA
* ** **
*******
D/UW-3/ GTTAGTGATGCTCGGAAAGGGTCTATTTTTTCTGTAGAGACTAGTTTGGA
L2/43
GTTAGTGATGCTCGGAAAGGGTCTATTTTTTCTGTAGAGACTAGTTTGGA
**************************************************
D/UW-3/ GATCTCAGGCGTCAAAAAAGGGGTCATGTTCGATAATAATGCCGGGAATT
L2/434 GATCTCAGGCGTCAAAAAAGGGGTCATGTTCGATAATAATGCCGGGAATT
**************************************************
Réponse :
+
-
la souche est de sérovar L
la souche appartient à un autre sérovar
Participation au réseau
•  40 Laboratoires dont 11 en île de France
(27%)
•  150 cliniciens dont  100 en île de France
(66%)
• Taux de réponse des cliniciens :  46%
Répartition géographique
Paris :
Province:
74%
26%
81% LGV
56% non L
Données biologiques
LGV
84%
50%
19%
HIV+
Syphilis
Gono+
nonL
54%
35%
31%
p
<10-8
0.04
0.1
Données cliniques
Symptômes cliniques
Écoulement rectal
Ulcération anale
LGV
98%
65%
40%
nonL
78%
37%
27%
p
<10-7
0.001
0.009
Données comportementales
MSM
Partenaire occasionnel
> 5 partenaires
LGV
97%
63%
46%
nonL
90%
56%
48%
p
0.06
0.1
0.1
IST C. trachomatis (D-K) non compliquées
• Doxycycline : Vibramycine® 100 mg
x2 /J, 7J
ou
• Azithromycine : Zithromax® 1 g,
à jeun, monodose
Traitement du / des partenaire(s)
Rapports sexuels protégés
LGV rectale à C. trachomatis
• Doxycycline : Vibramycine® 100 mg x2 /J,
21j
• Erythromycine
ou
500mg x2 /J,
21 j
• Azithromycine : Zithromax® durée et
posologie à valider
 Partenaire(s) ?
60 jours précédant le début des signes cliniques
Traitement des infections à C. trachomatis

Résistance acquise ?
Pas clair
mutations possibles in vitro
acquisition de gènes résistance ?

Echec thérapeutique ?
10%  persistance
 contrôle post-thérapeutique conseillé
à 5-6 semaines arrêt du traitement
 contrôle de non recontamination à
3 – 4 mois
Les mycoplasmes uro-génitaux
Pouvoir pathogène
Femme (hors grossesse)
Homme
Ureaplasma
commensaux
non pathogènes
opportunistes
UNG si > seuil
M. hominis
participe à la vaginose
Non pathogène
M.genitalium
cervicite
urétrite
chronique
Les mycoplasmes uro-génitaux
Rechercher : lequel? Quand? Comment?
Ureaplasma
uniquement chez l’homme devant une UNG
sur 1er jet d’urine ou pvt urétral
culture quantitative
critère de pathogénicité
> 104 UCC/ml urètre
> 103 UCC/ml urine
M. hominis
inutile chez l’homme ou la femme (hors grossesse
ou infection haute)
M.genitalium chez l’homme devant une UNG
surtout récidivante
1er jet d’urine ou pvt urétral
par PCR
Sensibilité et résistance naturelles
• Tous les mycoplasmes résistent aux:
- bétalactamines
- rifampicine
- polymyxins, acide nalidixique, sulfamides
• Antibiotiques potentiellement actifs in vitro:
- Tetracyclines
- MLSK
- Fluoroquinolones
- Chloramphenicol
- Aminoglycosides
Résistance acquise chez les mycoplasmes
• Concerne tous les antibiotiques de 1ère intention
tetracyclines, MLSK, fluoroquinolones
• In vitro, la sélection de mutants résistants
est possible avec tous les mycoplasmes humains
et tous les AB
• In vivo, variable suivant l’AB et l’espèce
Résistance acquise.
• Résistance aux tetracyclines
- 19 % Mh, 4 % U spp.
- acquisition du gène tet(M)
• Résistance aux macrolides
- rares cas chez Mh (R à josamycine) et U spp.
- 10% M. genitalium (azythromycine)
- mutations dans gène 23S rRNA
• Résistance aux fluoroquinolones (FQ)
- rares cas chez les immunodéprimés traités par FQ
- observée chez Mh et U spp. (1 % isolats)
- altération de la cible
Traitement des urétrites masculines
à mycoplasmes
U. urealyticum: UNG (comme C. trachomatis)
Azithromycine monodose
Doxycycline 7 jours
M. genitalium: UNG
ttt dox : taux d’échec 60%
ttt azi : taux d’échec 28%
Recommandations :
5 jours d’azithromycine 500mg 1er jour
puis 250 mg pdt 4 jours
Ou
400mg /j pdt 10j Moxifloxacine
(à réserver)
IST à CT/NG/MG: fréquence ?
Données Bordeaux 4 mois 2011
Tout venant
CT
NG
MG
9,1%
1,5%
4,6%
Symptomatiques
CIDDIST
7,5%
3,3%
3%
Infections mixtes : 14 cas
CT/MG = 3 cas CT/NG = 8 cas
Asymptomatiques
CDAG
IVG
PF
7%
7%
4,7%
0,2% 1,5% 0%
NF
3%
0,7%
NG/MG = 1 cas
Proportion infections mixtes
CT = 8,5% (13/153)
NG = 44% (11/25)
CT/NG/MG = 2 cas
MG = 16% (6/36)
Recommandations
• Diagnostic
– CT/NG (a- et symptomatiques)
– Si persistance des symptômes : MG
– Avenir : CT/NG/MG
• Traitement
– Si NG+ associer traitement CT
– Si persistance des symptômes , traiter MG

similar documents