phoA in pEK8

Report
phoA in pEK8
Ampicillin resistant
Native promoter
Wild type enzyme
HindIII
BsteII
5’
3’
Start
Codon
Stop
Codon
Potential New Plasmids
pET29a
HindIII
BsteII
5’
3’
Start
Codon
Stop
Codon
pET29a
We want a C-terminal histidine tag
We do not want an S-Tag
HindIII
BsteII
3’
5’
Start
Codon
Stop
Codon
New TAA
Stop codon
We want a C-terminal histidine tag
We do not want an S-Tag
HindIII
BsteII
3’
5’
Start
Codon
Stop
Codon
HindIII
NdeI
XhoI
BsteII
3’
5’
Start
Codon
Stop
Codon
phoA Primer Design
• Find the sequence of phoA in pEK48
• Append new endonuclease cut sites
• Delete the stop codon
• Do some tinkering with Tm and ends
phoA Sequence
NCBI BLAST
Expasy Translate
TTGTCACGGCCGAGACTTATAGTCGCTTTGTTTTTATTTTTTAATGTATTTGTACATGGAGAAAATAAAGTGAAACAAAGCACTATTGCACTGGCA
CTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCCCGGACACCAGAAATGCCTGTTCTGGAAAACCGGGCTGCTCAGGGCGATATTACTGCACCCGGCGGTGCTCGCCGTTTAACG
GGTGATCAGACTGCCGCTCTGCGTGATTCTCTTAGCGATAAACCTGCAAAAAATATTATTTTGCTGATTGGCGATGGGATGGGGGACTCGGAAATTACTGCCGCACGTAATTATGCC
GAAGGTGCGGGCGGCTTTTTTAAAGGTATAGATGCCTTACCGCTTACCGGGCAATACACTCACTATGCGCTGAATAAAAAAACCGGCAAACCGGACTACGTCACCGACTCGGCTGCA
TCAGCAACCGCCTGGTCAACCGGTGTCAAAACCTATAACGGCGCGCTGGGCGTCGATATTCACGAAAAAGATCACCCAACGATTCTGGAAATGGCAAAAGCCGCAGGTCTGGCGACC
GGTAACGTTTCTACCGCAGAGTTGCAGGATGCCACGCCCGCTGCGCTGGTGGCACATGTGACCTCGCGCAAATGCTACGGTCCGAGCGCGACCAGTGAAAAATGTCCGGGTAACGCT
CTGGAAAAAGGCGGAAAAGGATCGATTACCGAACAGCTGCTTAACGCTCGTGCCGACGTTACGCTTGGCGGCGGCGCAAAAACCTTTGCTGAAACGGCAACCGCTGGTGAATGGCAG
GGAAAAACGCTGCGTGAACAGGCACAGGCGCGTGGTTATCAGTTGGTGAGCGATGCTGCCTCACTGAATTCGGTGACGGAAGCGAATCAGCAAAAACCCCTGCTTGGCCTGTTTGCT
GACGGCAATATGCCAGTGCGCTGGCTAGGACCGAAAGCAACGTACCATGGCAATATCGATAAGCCCGCAGTCACCTGTACGCCAAATCCGCAACGTAATGACAGTGTACCAACCCTG
GCGCAGATGACCGACAAAGCCATTGAATTGTTGAGTAAAAATGAGAAAGGCTTTTTCCTGCAAGTTGAAGGTGCGTCAATCGATAAACAGGATCATGCTGCGAATCCTTGTGGGCAA
ATTGGCGAGACGGTCGATCTCGATGAAGCCGTACAACGGGCGCTGGAATTCGCTAAAAAGGAGGGTAACACGCTGGTCATAGTCACCGCTGATCACGCCCACGCCAGCCAGATTGTT
GCGCCGGATACCAAAGCTCCGGGCCTCACCCAGGCGCTAAATACCAAAGATGGCGCAGTGATGGTGATGAGTTACGGGAACTCCGAAGAGGATTCACAAGAACATACCGGCAGTCAG
ACCGATCTCTTCTACACCATGAAAGCCGCTCTGGG
TTGCGTATTGCGGCGTATGGCCCGCATGCCGCCAATGTTGTTGGACTGACCGACCAG
GCTGAAATAA
E. coli strain K-12 bases 400902 - 402368
E. coli K-12 Start
Codons
• 4288 open reading frames
• 3542 start with ATG, 83% methionine
• 612 start with GTG, 14% valine
• 130 start with TTG, 3% luecine
Blattner FR, Plunkett G 3rd, Bloch CA, Perna NT, Burland V, Riley M, Collado-Vides J, Glasner JD, Rode CK, Mayhew GF, Gregor J, Davis NW, Kirkpatrick
HA, Goeden MA, Rose DJ, Mau B, Shao Y. The complete genome sequence of Escherichia coli K-12. Science. 1997 Sep 5 277(5331):1453-62
Forward Primer
NdeI
5’ TTGAUGTCACGGCCGAGACTTATAGTCGCTTTG
5’ CATATGAUGTCACGGCCGAGACTTATAGTCGCTTTG
5’ AAAAAAAACATATGAUGTCACGGCCGAGACTTATAGTCGCTTTG
Reverse Primer
XhoI
5’ ACCGATCTCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAATAA
5’ ACCGATCTCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAACTCGAG
5’ ACCGATCTCTTCTACACCATGAAAGCCGCTCTGGGGCTGAAACTCGAGTTTTTTTT
Reverse and complement
5’AAAAAAAACTCGAGTTTCAGCCCCAGAGCGGCTTTCATGGTGTAGAAGAGATCGGT
Melting Temperature
• Melting temperature to be between 55
and 60 C
• Melting temperatures to be as close to
one another as possible
Melting Temperature Calculator
pASK IBA 43+

similar documents