prokaryota

Report
Molekulární biologie
8.
Syntéza proteinů
priony
. 13)
kapitola
Syntéza proteinů
TRANSLACE
tRNA
místo pro navázání
aminokyseliny
(CCA konec)
akceptorový
stonek
T smyčka
D smyčka
variabilní smyčka
antikodonová smyčka
Jetelový list v 2-D zobrazení
Tvar písmene L ve 3-D zobrazení
Struktura tRNA / video
http://www.youtube.com/watch?v=4MRCH_J7Fhk
tRNA obsahuje báze modifikované až po transkripci RNA
D-smyčka = dihydrouracil
uracil
dihydrouracil
T-smyčka = TyC = thymin a pseudouracil
uracil
Důležité pro sestavení terciální
struktury tRNA a pro vazbu
ribozomu
pseudouracil
metylace
uracil
thymin
Báze modifikované v tRNA
Antikodon v tRNA rozeznává kodon v mRNA
párování přes vodíkové můstky
1 tRNA = 1 aminokyselina
Genetický kód
64 kodonů
20 aminokyselin
Existuje více
tRNA pro stejnou
aminokyselinu,
minimálně 31
rozdílných tRNA
v každé buňce
Proč jich není
64-3, tedy 61?
AUG = methionine (nebo GUG-valin): start kodon
UAA, UAG, UGA: stop kodon
Některé tRNA rozeznávají více než jeden kodon
1. nukleotid antikodou a 3. nukleotid kodonu
nepárují zcela přesně
‘Wobbling' rules
Univerzální čtecí kód neplatí vždycky
výjimky v mitochondriích a některých mikroorganizmech
Nabíjení tRNA aminokyselinou
1. formace aminoacyl AMP
AK + ATP = aminoacyl AMP + PPi
aminoacyl-AMP
2. přenos na tRNA
aminoacyl AMP + tRNA =
aminoacyl tRNA + AMP
aminoacyl-tRNA
aminoacyl tRNA syntetázy
rozpoznávají antikodon a akceptorový stonek, vážou ATP a AK
1 AK = 1 aminoacyl tRNA syntetáza, tedy 20 různých syntetáz v buňce
Nabíjení tRNA / video
http://www.phschool.com/science/biology_place/biocoach/translation/addaa.html
RIBOZÓM – komplex RNA a proteinů
rRNA
2/3 RNA, 1/3 proteiny (kolem padesáti)
S (Swedberg) – sedimentační koeficient
Velká podjednotka (hlavně 23S) funguje jako peptidyl transferáza
= má katalytickou funkci
RIBOZYM
Pouze část mRNA se translatuje do proteinu
gen
promotor
mRNA
5’UTR
ATG
ORF
3’UTR
protein
Oblasti v 5’UTR a 3’UTR pro regulaci stability mRNA nebo účinnosti translace
Genetický kód lze číst třemi způsoby, podle toho, kde je začátek!
RŮZNÉ ČTECÍ RÁMCE V RNA
STEJNÁ SEKVENCE
Různé čtecí rámce (ORFy)
+1 frameshift
+2 frameshift
Genetická informace v každém čtecím rámci je jiná
Kde najít na mRNA počátek translace?
…CAAAUGUAUGCAUGCCAAAGGAGGCAUGUAAGGA…
Každá mRNA obsahuje mnoho potenciálních AUG start kodonů
První AUG za místem nasednutí ribozomu bude bráno jako počátek translace.
Místo nasednutí ribozomu
Shine Dalgarno sekvence na mRNA
(aneb ribosome binding site = RBS)
anti Shine Dalgarno sekvence
na 16S rRNA (malá podjednotka)
Přesné párování - vysoká účinnost translace
Nepřesné párování – nižší účinnost translace
PROKARYOTA
Iniciátorová tRNA
Rozpoznává start kodon:
• ve většine případů AUG
• zřídka GUG, ale i zde kóduje Met (not Val)
(u proteinů s velice nízkou expresí)
• váže se rovnou do P-místa ribozomu (ne A)
prokaryota – N-formyl-methionin
eukaryota - methionin
po translaci často odštípnut
Sestavení iniciačního komplexu
PROKARYOTA
1. mRNA naváže samostatnou malou
podjednotku na SD sekvenci
2. navázání iniciátorové tRNA do AUG
3. navázání iniciačních faktorů
30S
iniciační
komplex
IF2, IF1 – stabilizují fMet-tRNA
IF3 – rozpoznává AUG a antikodon v
fMet-tRNA a brání také předčasnému
navázání velké podjednotky
4. Uvolnění IF3, nasednutí velké
podjednotky, uvolnění IF1 a IF2 za
spotřeby GTP
70S
iniciační
komplex
místo výstupu (E, exit)
akceptorové místo (A)
peptidové místo (P)
3D struktura ribozomu (prokaryotního 70S)
Rozhraní mezi malou +
velkou podjednotkou tvoří
vazebná místa pro mRNA a
pro tRNA
Figure 6-64 Molecular Biology of the Cell (© Garland Science 2008)
Prokaryotní inciace/ video
http://booksite.academicpress.com/Clark/molecular2/anim13_ri
bosome_assembly_translation_complexes.php
Elongace
PROKARYOTA
Vždy maximálně 2
tRNA vázány
současně na jednom
ribozomu
• tRNA přináší novou aminokyselinu, váže se do akceptorového místa za pomoci EF-T
• 23S rRNA velké podjednotky katalyzuje peptidyl transferázovou reakci – spojení
předchozího peptidického řetězce s novou aminkyselinou na tRNA v A místě
• tRNA s novým peptidem se nakloní směrem k P, díky EF-G (elongation factor G)
• translokace – mRNA se posune podél ribozomu, tRNA se posune z A do P a z P do E
• odpadne EF-G, umožní odpadnutí tRNA z E
Terminace
PROKARYOTA
• stop kodon na mRNA: UAA, UAG, UGA
• neexistuje žádná tRNA, ale jsou
rozpoznávány uvolňovacími faktory (RF1
nebo RF2, release factors)
• peptid je odštěpen peptidyltransferázovou
aktivitou ribozomu, tRNA se posune do E
místa a odpadne
• RRF (ribosome recycling factor) uvolní
velkou podjednotku
• uvolnění malé podjednotky a mRNA
Prokaryotní translace / video
http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm
http://booksite.academicpress.com/Clark/molecular2/anim13_translation_in_bacteria.php
Prokaryotní mRNA je polycistronní, obsahuje více ORF
Shine Dalgarno
sekvence
Shine Dalgarno
sekvence
Shine Dalgarno
sekvence
Každý ORF musí mít svou SD sekvenci, kde nasedne ribozom.
Trypanosoma – jediný Eukaryot s polycistronními transkripty
U prokaryot probíhá transkripce a translace současně
U eukaryot transkripce v jádře
(navíc sestřih), ale translace na
ribozomech v endoplazmatickém
retikulu nebo v cytoplazmě
Bakteriální polyzom není cirkulární.
Ribozomy jdou přímo napojeny na RNA polymerázu přes NusEG komplex
Polyzom (polyribozom)
mRNA pokrytá více ribozomy najednou, přibližně 100 bazí od sebe
Polyzom eukaryotní buňky je cirkulární
elektronový snímek
Poly(A) vazebné proteiny vážou eIF4 na čepičce mRNA
PROKARYOTA
Problém pozastavených ribozomů
(stalled ribosomes)
• ribozom se uvolní z mRNA pouze
pokud se navážou release faktory
(RF1 a RF2)
• mRNA neobsahující STOP kodon
budou akumulovat ribozomy
tmRNA
• vypadá trochu jako tRNA (ale bez
antikodonu) a trochu jako mRNA
• jako tRNA váže aminokyselinu (alanin)
• pokud najde pozastavený ribozom,
naváže se vedle defektní mRNA a
slouží jako templát pro translaci
• translatuje se 11 aminokyselin a
STOP kodon = značka pro degradaci
tohoto proteinu (proteasomem)
Eukaryota – cirkulární polysom, problem odpadá
Místo toho nonsense mediated decay mRNA s predcasnými stop kodony
ROZDÍLY EUKARYOTNÍ JADERNÉ TRANSLACE
VIDEO: http://booksite.academicpress.com/Clark/molecular2anim13_eukaryote_initiation.php
Komplex vázající
čepičku
43S preiniciační
komplex
EUKARYOTA
1. Sestavení komplexu
vázající čepičku a
polyA konec
polyA binding protein
eIF4E,G,A,B
2. Sestavení
preiniciačního
komplexu s tRNA a
malou podjednotkou
ribosomu, za pomoci
eIF2
3. Vazba preiniciačního
komplexu na
komplex vázající
čepičku, skenování k
prvnímu AUG
za spotřeby ATP
Skenování mRNA
do prvního AUG
Pokud AUG příliš vzdálená
konsensu GCCRCCAUGG, první
AUG nemusí být rozpoznáno
VIDEO: http://booksite.academicpress.com/Clark/molecular2anim13_eukaryote_initiation.php
EUKARYOTA
4. odpoutání eIF1,2,3,5
5. nasednutí velké podjednotky
6. počátek elongace
(velice podobná prokaryotům)
EUKARYOTA
Terminace translace
 místo dvou uvolňovacích faktorů (RF1 a 2) rozeznává eRF1 všechny tři kodony
 terminace vyžaduje GTP (hydrolyzovaný pomocí eRF3)
 uvolnění velké podjednotky pomocí eIF3, uvolnění malé podjednotky a mRNA
I R E S (internal ribosome entry site)
 několik výjimek u eukaryot a virů, kde ribozom nasedá přímo uvnitř mRNA,
ne na čepičku
PROKARYOTA
GLOBÁLNÍ REGULACE TRANSLACE
ribosome modulation factor
Dimerizace ribozomů
Při obdobích s pomalým
růstem buňky jsou
přebytečné ribozomy
inaktivovány jejich
dimerizací pomocí RMF
2/3 obsahu buňky jsou proteiny, velmi energeticky náročné,
proto regulace proti plýtvání…
PROKARYOTA
Stringent response
Odpověď bakterií na hladovění, tepelný šok nebo jiný stres
vazba nenabité tRNA (kvůli nedostatku aminokyselin) do A místa
syntéza pppGpp RelA proteinem
vazba ppGpp na polymerázu,
změna specificity její vazby na DNA
Zastavení exprese
většiny genů
Spuštěny geny pro
přežití a virulenci
EUKARYOTA
Inaktivace eIF2
Při hladovění se sníží většina translace inaktivací iniciačního faktoru eIF2
iniciace
uvolnění eIF2 po iniciaci,
jeho recyklace pomocí eIF2B:
Vysoká
syntéza
proteinů
Forsforylace eIF2
Nízká
syntéza
proteinů
Fosforylace eIF2 brání funkci eIF2B a recyklaci eIF2
= eIF2 není k dispozici pro iniciaci translace
Přednáška 6
Další příklady regulace translace,
u specifických transkriptů
Selenocystein (Sec)
• 21. kódovaná aminokyselina
• vyskytuje se vzácně v proteinech prokaryot i eukaryot
• tRNA nabitá serinem, ale pak enzymaticky modifikován na selenocystein
serin
selenocystein
• Selenocystein kódován UGA kodonem, který normálně znamená STOP
• pokud za UGA kodonem následuje SECIS sekvence (selenocystein insertion sequence),
přepíše se jako selenocystein a translace pokračuje
SECIS sekvence na mRNA tvoří vlásenku
Pyrrolysin (Pyl)
• 22. kódovaná aminokyselina
• vyskytuje se vzácně v proteinech u Archea
• lysin napřed enzymaticky modifikován na pyrrolysin, pak teprve navázán na tRNA
• kódován UAG kodonem, který normálně znamená STOP
Kolik produktů z jednoho genu?
nekódující RNA
Ačkoliv prokaryotní a eukaryotní ribozomy plní stejnou funkci,
nemají úplně stejnou strukturu
Mnoho antibiotik je založeno na inhibici bakteriální (a pouze bakteriální) translace
30S
Figure 6-79 Molecular Biology of the Cell (© Garland Science 2008)
50S
Inhibitory proteinové syntézy a transkripce
Table 6-4 Molecular Biology of the Cell (© Garland Science 2008)
Priony
Proteiny schopné měnit konformaci jiných proteinových molekul stejného druhu
o PrP protein původcem několika typů prionového onemocnění mozku savců
o přirozeně exprimován na povrchu nervových buněk v mozku
o glykoprotein s cukernými zbytky, upevněn v membráně díky fosfolipidové kotvě
o přirozená funkce neznámá, možná ochrana před oxidativním stresem neuronů
(obsahuje Cu)
o existuje ve dvou alternativních konformacích: PrPC a PrPSc
o PrPSc je schopný polymerizovat do fibrilárních agregátu, což je pro buňku toxické
(kapitola 21, strana 681)
normální
PrPC
patologický
PrPSc
PrPSc se chová jako infekční protein
Tvoří dimer s přirozeným PrPC
a změní jeho konformaci na PrPSc
PRION = infekční agens bez DNA nebo RNA
Vznik prionového onemocnění
PrPSc
PrPSc
a) spontánní konformační změna (bez změn na
DNA); trvá léta, než se PrPSc akumuluje
b) dědičná mutace s predispozicí ke špatné
konformaci tvořeného PrP
•Creutzfeld-Jacob disease
•Gertsmann Straussler Scheinker syndrome
•fatal familiar insomnia
a) přenos mezi jedinci (stejného či jiného druhu)
přenosná spongiformní encefalitida (TSE)
= syrové maso, sliny, trus
• scrapie – u ovcí a koz
• nemoc šílených krav (BSE) – obdoba
scrapie u dobytka, přenosné na člověka
Priony také u některých hub (kvasinek), ale tam pro buňku prospěšné, adaptace na okolní podmínky
Video z časopisu Nature, výborné…!!
http://www.onlinevideolecture.com/medical-science/teabiotech/educationalmolecular-biology/index.php?course_id=3942&lecture_no=9

similar documents