2.4 Molecules to Metabolism NOTES - Proteins

Report
Biology Journal 9/16/2014
2.4 Homework Quiz!
1.True or false: Amino acids are bonded together
in long chains by what are known as peptide
bonds.
2.True or false: The sequence of amino acids for a
protein is found on code of the DNA.
3.How many different kinds of amino acids are
used by ribosomes to make proteins?
4.What is a proteome?
Topic 2: Molecular biology (21 hours)
2.4 Proteins: Proteins have a very wide range of functions in living organisms.
Nature of science: Looking for patterns, trends and discrepancies—most but not all organisms assemble
proteins from the same amino acids.
Understandings:
• Amino acids are linked together by condensation to form
polypeptides.
• There are 20 different amino acids in polypeptides synthesized on
ribosomes.
• Amino acids can be linked together in any sequence giving a huge
range of possible polypeptides. Most organisms use the same 20
amino acids in the same genetic code although there are some
exceptions. Specific examples could be used for illustration.
• The amino acid sequence of polypeptides is coded for by genes.
• A protein may consist of a single polypeptide or more than one
polypeptide linked.
• The amino acid sequence determines the 3-D conformation of a
protein.
• Living organisms synthesize many different proteins with a wide
range of functions.
• Every individual has a unique proteome.
Applications and skills:
Application: Rubisco, insulin,
immunoglobulins, rhodopsin, collagen
and spider silk as examples of the range
of protein functions.
Application: Denaturation of proteins
by heat or by deviation of pH from the
optimum. Egg white or albumin
solutions can be used in denaturation
experiments.
Application: Proteomics and the
production of proteins by cells cultured
in fermenters offer many opportunities
for the food, pharmaceutical and other
industries.
Skill: Drawing molecular diagrams to
show the formation of a peptide bond.
Aims: Obtaining samples of human blood for immunological, pharmaceutical and anthropological studies is an
international endeavour with many ethical issues.
Review!
a. What kind
is this?
It’sof
anmolecule
amino acid!
(thisare
one
calledcalled?
asparagine)
b. What
itsisparts
R group
(in this case CH2CONH2)
Amine
(NH2)
Carboxyl
(COOH)
Alpha carbon
(the middle C where the R group is attached)
Protein and Amino Acids
•Proteins do everything!
Protein makes skin stretchy,
bones tough, gives your body
parts their color, lets you
digest different foods, makes
up hormones, creates your
immune system …
• Proteins are 1 chain of amino acids (sometimes
multiple), that fold up into specific shapes based
on the chemical properties of the amino acids.
Generalized Amino Acid
How many amino acids make up this polypeptide?
There are 20 kinds of amino acids used in the
human body.
Ribosomes: part of the cell that makes
proteins from an RNA copy of the DNA
code. They join amino acids together
What do
with peptide bonds.
ribosomes
do?
There are infinite possibilities of proteins! They can
be any length, and any combination of amino acids.
• We can break
down proteins we
eat to get energy /
amino acids.
• Proteins can irreversibly lose their
specific shape through a process called
denaturing. Causes:
1. Changes in temperature
2. Changes in pH
Denaturing
A fever can kill you! Why?
Proteome: The set of all of the
proteins an organism makes.
DNA in 23
chromosomes
Transcribed into
mRNA
Genome
Translated into an
amino acid sequence
by ribosomes
Proteome
Folds into
proteins
Polypeptide
Every individual has its own unique genome
which leads to its own unique proteome
Proteins do everything! Such as…
Motor Proteins: They move, allowing
cells to change shape. Muscle cells
are packed with these.
Proteins do everything! Such as…
Transport Proteins: These are proteins stuck
in the cell membrane that let specific
substances in or out of your cells.
Proteins do everything! Such as…
Receptor Proteins: These are proteins stuck
in the cell membrane that are used for cells to
communicate with eachother.
Proteins do everything! Such as…
• Your immune system tells the
difference between “self” and
“non-self” by these receptors.
• Blood types are an example of receptor
proteins .
• The blood types are:
A, B, AB and O
• Doctors killed a lot of
dogs before they
figured this one out…
Why is meat high in protein?
Muscles are made of protein. Meat is high
in protein because meat is animal muscle.
There are many ways of representing proteins
DNA Helicase
Simplified
model
There are many ways of representing proteins
DNA Helicase
Space-filling
model
There are many ways of representing proteins
DNA Helicase
Model showing
-helixes and
-sheets.
20 amino acids bonded together in
different orders can form all proteins.
What do proteins do?
Everything!
The function of the protein is defined by its
shape.
20 amino acids bonded together in
different orders can form all proteins.
Fibrous
Long, insoluble proteins
Parallel polypeptide chains
Cross-linked
Spider Silk
20 amino acids bonded together in
different orders can form all proteins.
Globular
Folded, compact polypeptide chains
Almost spherical shapes
Rubisco
Rhodopsin
Insulin
Immunoglobulin
Denaturation
A process that destroys the complex structure of
a protein.
1. Heat
2. Strong acids
3. Strong alkalis
New structure = new function
Denaturation of an egg protein
Proteomics
DNA in 23
chromosomes
Transcribed into
mRNA
Genome
Translated into an
amino acid sequence
by ribosomes
Proteome
Folds into
proteins
Polypeptide
Every individual has its own unique genome
which leads to its own unique proteome
A chemical reaction is shown below.
1. Name each reactant and product.
2. What kind of reaction is this?
3. Where should water be present in the reaction?
How many molecules of water?
Catabolic Hydrolysis Reaction
Monopeptide
(amino acid)
Dipeptide
+ H2O
Monopeptide
(amino acid)
→
• Hydrolysis (water is split)
• It “fills in” each monomer
A chemical reaction is shown below.
1. Name each reactant and product.
2. What kind of reaction is this?
3. Where should water be present in the reaction?
How many molecules of water?
→
A chemical reaction is shown below.
1. Name each reactant and product.
2. What kind of reaction is this?
3. Where should water be present in the reaction?
How many molecules of water?
Catabolic Hydrolysis Reaction
Monopeptide
(amino acid)
Dipeptide
+ H2O
Monopeptide
(amino acid)
→
• Hydrolysis (water is split)
• It “fills in” each monomer
Transcription and
Translation
DNA has the “recipe” to make proteins.
A gene is a segment
of DNA that has the
instructions to make
a particular protein.
“Hmmm… how many teaspoons of
cytosine was I supposed to add?”
The base pairs on DNA
determine the amino
acids, and thus the
specific shape, that the
protein will have.
For example… we all have genes for hair color. The
base pairs on this DNA determines what proteins are in
our hair, and thus, what our hair looks like.
Of course, you can
always change it later…
What does it mean
to be a translator?
What does it
mean to
transcribe
something?
What’s the difference between
DNA and RNA?
DNA Structure
•Deoxyribonucleic
acid
•Double stranded
•Uses thymine (T)
•Sugar used is
deoxyribose (C5H10O4)
RNA Structure
•Ribonucleic
acid
•Single stranded
•Uses uracil (U)
•Sugar used is
ribose (C5H10O5)
DNA and RNA comparison
When does your body need to make
different kinds of proteins?
Transcription and translation is done
every time a cell makes a protein.
So, almost every cell in your
body is doing this all the time!
Above: the
structural protein
collagen. This poor
guy will be making
lots of it soon to
repair his body.
Ancient Egypt was well known for its
scribes that made copies of documents.
Nowadays we
don’t really need
them, we have
copy machines…
Transcription is making a copy of the DNA onto
mRNA (messenger RNA). The enzyme that makes it
is called RNA polymerase.
Some people
transcribe
their homework
all the time.
mRNA is a temporary, disposable copy of DNA.
It’s sent from the nucleus to the ribosome.
DNA is permanent.
You don’t want to
change or mess with it.
RNA is a disposable copy.
If this was a chain of DNA, what
would the mRNA strand be?
CTGACTTAGATA
GACUGAAUCUAU
What does DNA have the
“recipe” to make?
DNA is the recipe to make protein!
What do
ribosomes
do?
Ribosomes make proteins!
What are proteins made out of? Why do
they have the shape that they have?
Proteins are made out of amino acids. The
different chemical properties of the amino
acids cause the chain to fold up in specific
ways.
Translation: mRNA goes to the ribosome,
and it is translated into an amino acid
sequence.
tRNA (transfer
RNA) brings the
correct amino
acid for every 3
base pairs.
•Ribosomes have 2 “subunits” or pieces.
Large Subunit
Small Subunit
The 3 bases on
tRNA is called
an anti-codon.
The 3 bases on
mRNA is called a
codon.
How many different kinds of amino
acids are used in the human body?
Every 3 base pairs corresponds
to a different amino acid.
What amino acids does this mRNA code for?
AUG
UUA GAC CUC UGA
A translator puts information from one
language into another.
Translation puts the genetic code (AGTC’s)
into the code of amino acids.
What amino acids does this mRNA code for?
GUA AAA CUU CUA UAG
The translator
(ribosome and tRNA)
The scribe
(RNA polymerase)
Protein
DNA
mRNA
What do we call
this step?
Transcription
What do we call this
step?
Translation
Convert the DNA to mRNA
Then, Convert the mRNA to amino acids.
GCC TAT TCA CTA CTG
CGG AUA AGU GAU GAC
Argenine
Isoleucine
Serine
Aspartic Acid
What do we call this step?
Transcription
What do we call this step?
Translation
Aspartic Acid
Making a Protein
Making a Protein
This is called the central dogma of biology.
(That just means that it is a really
important idea)
•At the start of every gene is a TATA box. It
tells the mRNA polymerase where to start
copying.
TATA box
Actual gene being transcribed
DNA strand:
TCCACGACTATACCGACTACTCTACGGGAATATG
mRNA strand:
GGCUGAUGAGAUGCCCUUAUAC
•mRNA gets a 5’GTP and a poly-A tail to
mark the beginning and end. This helps
identify it and “protect” it.
5’ GTP
Poly-A tail
PPPG
AAAAAAAAA
Biology Journal 10/18/2013
Transcription
RNA polymerase
Replication
DNA helicase
DNA polymerase
mRNA
Translation
Ribosome
tRNA
Protein
DNA
Happens in the nucleus
Happens in the cytoplasm /
at the ribosomes
Label each molecule (the pictures).
Label the process that makes each molecule (the purple arrows).
List the name of the enzymes / molecules that carry out each process.
Identify the location where each of these molecules / processes are.
This is called the central dogma of biology.
(That just means that it is a really
important idea)

similar documents