DNA replication, transcription & translation

Report
Replication,
Transcription and
Translation
Honors Biology
Powerpoint #2 – Chapter 12
Warm Up: Base Pairing
1.
A C C T GA
2.
G C
T
G
A
AG
What is the DNA ‘backbone’
made of?

Phosphate
and Sugar
DNA Replication
Nucleotide
Hydrogen
bonds
Sugar-phosphate
backbone
Key
Adenine (A)
Thymine (T)
Cytosine (C)
Guanine (G)
What is DNA replication?
Making a copy of DNA
Why is DNA replication important for
cells and multicellular organisms?
Replication allows cells to divide
Forming cells that are genetically
identical to the original
When does DNA Replication occur?
After the cell grows
big enough to divide,
during interphase, the
“S” phase
DNA Replication
New strand
Original
strand
DNA
polymerase
Growth
DNA
polymerase
Growth
Replication
fork
Replication
fork
New strand
Original
strand
Nitrogenous
bases
Important Enzyme #1
Helicase
 Unwinds DNA at the replication fork.
Important Enzyme #2
DNA Polymerase
 Principal enzyme in DNA replication;
adds nucleotides to growing strand
of DNA and proofreads new strand
of DNA
Steps in DNA Replication
1. Helicase enzyme breaks the hydrogen bonds between base pairs. This
unzips the double helix at a position called the replication fork.
2. There is an abundant supply of nucleotides in the nucleus for the
formation of the new polynucleotides.
3. Nucleotides base pair to the bases in the original strands with hydrogen
bonds.
4. DNA polymerase joins together the nucleotides together with strong
covalent bonds to form a new complementary polynucleotide strand.
5. The double strand reforms a double helix.
6. Two copies of the DNA molecule form behind the replication fork. These
are the new daughter chromosomes.
Drawings of the steps in DNA
Replication
DNA
Polymerase
Helicase
Some Important DNA Facts


A strand of DNA has 2
ends, the 5’ (5-prime)
and 3’ (3-prime) ends.
DNA is ALWAYS copied
from 5’ to 3’
Some Important DNA Facts

There are multiple ‘bubbles’ of DNA replicated
at the same time
What is ‘semi-conservative’ replication?

In the new DNA created, one strand is
from the original, and one is a new one.
Semi = part of
Conserve = save
Why is ‘semi-conservative’ important?

The DNA is copied EXACTLY generation
to generation
RNA
Where is DNA stored?
Nucleus
______________________
 What organelle makes proteins?
Ribosomes
______________________
 Where are proteins made?
Cytoplasm
______________________

What problem might this pose?

DNA can not take directions for making
proteins to the ribosomes.
How does RNA solve this problem?

RNA is a disposable copy of DNA
that can leave the nucleus
B. RNA’s structure is very similar to the structure of
DNA except for 3 major differences:
1.
RNA has ribose sugar instead
of deoxyribose
Nitrogen Base
2. RNA is single-stranded
3. RNA has uracil (U) instead of
thymine (T)
DNA: AGTCCTTTAGT
RNA: AGUCCUUUAGU
There are three main types of RNA:
1. Ribosomal RNA (rRNA)
rRNA is found in
ribosomes, and
creates the active
site for protein
formation
2. Transfer RNA (tRNA)
tRNA contains the
anticodon, and
brings amino acids
to create proteins
3. Messenger RNA (mRNA)
mRNA provides
the template for
making proteins
III. Transcription
A.
Transcription: Producing RNA by copying part of
the DNA’s nucleotide sequence
Adenine (DNA and RNA)
Cystosine (DNA and RNA)
Guanine(DNA and RNA)
Thymine (DNA only)
Uracil (RNA only)
RNA
polymerase
DNA
RNA
B.
Describe the process of transcription using drawings.
1. RNA Polymerase
rips open the DNA
double helix
2. RNA polymerase
grabs bases and lines
them up with the
original DNA strand
3. Half of the DNA is
copied into a strand
of mRNA, then the
DNA strand closes,
hydrogen bonds
reform
Transcription
C. How does RNA polymerase know
where to start?
Starts when it finds
a “promoter”
(specific base
sequence)
Found near the
beginning of a
gene sequence
D. Describe the process of RNA editing



RNA editing is a process that occurs in
the nucleus.
It removes introns “intervening
sequences” and leaves mRNA with only
the exons “expressed sequences.”
After editing a cap and tail are attached
and the mRNA is ready to enter into the
cytoplasm.
IV. Translation
A.
B.

Proteins are long chains of amino acids.
Codon: 3 consecutive nucleotides that
“code” for a specific amino acid.
What is the universal “start” codon:


AUG
What are the three “stop” codons?
 UGA, UAA, UAG
The Genetic Code
The Genetic Code
C. Use the genetic code below to translate
the following mRNA sequences:
mRNA:
AUGUAUCGGGCAUUUUAA
1.
mRNA:
UCCAUGGAAGUGAUUCCAUAA
2.
mRNA:
CCAUGUGUCCCCAAUGAAAA
3.
C. Use the genetic code below to translate
the following mRNA sequences:
mRNA:
AUGUAUCGGGCAUUUUAA
1.
Methionine (START), Tyrosine, Arginine, Alanine, Phenylaline, STOP.
mRNA:
UCCAUGGAAGUGAUUCCAUAA
2.
Serine, Methionine, Glutamic Acid, Valine, Isoleucine, Proline, STOP
mRNA:
CCAUGUGUCCCCAAUGAAAA
3.
Methionine, Cysteine, Proline, Glutamine, STOP, Lysine
D. Translation:
The decoding of
RNA into a
polypeptide
chain (protein)
The Central Dogma of
Biology is:
DNA  RNA  protein
E.
Where does the first step
take place? Nucleus
Where does the second
step take place?
Cytoplasm
F. What is the job of tRNA during translation?
Bringing amino acids to the ribosomes and
match them up with the correct base on
mRNA.
What is an anticodon? The three bases on a
tRNA that match with the mRNA codons.
G. What is the role of the ribosome during
translation? It is the site of protein
assembly
H.
1) mRNA is transcribed in the nucleus then
travels to the cytoplasm
Cytoplasm
Nucleus
mRNA
2) Ribosome grabs mRNA. tRNA brings amino acids
to the ribosome
Phenylalanine
Lysine (amino acid)
tRNA
Methionine
Ribosome
mRNA
Start codon
Cytoplasm
3) tRNA matches with complimentary mRNA.
Ribosome makes peptide bond between amino
acids, and breaks the bond between tRNA and
amino acid.
Peptide bond
mRNA
Ribosome
Lysine
tRNA
Translation direction
4) Peptide chain continues to grow until ribosome
reaches a stop codon
Protein is complete.
Growing polypeptide chain
Ribosome
tRNA
mRNA
Stop codon

similar documents