Diapositive 1 - Société algérienne d`hématologie et de transfusion

Report
Benchikh.N1; Nachi.M1 ; Moussaoui.R1 ; Belarbi.CF1 ; Messaoudi.A1; Arabi.A2;
Bekadja.MA2 ; Zatla.L3 ; Touhami.H3 ; Zouaoui - Benhadji.Z4 ; Mesli.N5;
Benmansour. M; Mehalhal.N6.
1.Service
de Biochimie, EHU 1er novembre, Oran ,Algérie
2.Service d’Hématologie et de Thérapie Cellulaire, EHU 1er novembre, Oran, Algérie.
3.Service d’Hématologie, CHU Oran, Algérie.
4.Service d’Hématologie, CHU Sidi-Bel-Abbès, Algérie.
5.Service d’Hématologie, CHU Tlemcen, Algérie.
6.Service d’Hématologie, EPH de Mascara, Algérie.
1
2
• Une mutation acquise du gène Janus Kinase 2 (JAK2) qui
transforme valine en phénylalanine en position 617 (V617F)
est impliquée de façon certaine dans la pathogénie des
syndromes myéloprolifératifs .
3
• La mutation JAK2 V617F est située dans le domaine
JH2 ou domaine pseudo-kinase de JAK2, qui régule
négativement l’activité kinase de la protéine.
4
• Elle entraîne une activation
de la voie de signalisation
même en l’absence de
cytokines essentielles pour
l’hématopoïèse (EPO,
TPO, G-CSF).
• La mutation entraine donc
une activation constitutive
du signal dans les cellules
de la lignée myéloïde et
une production excessive
de cellules sanguines
matures.
5
• La mutation JAK2 V617F est présente dans plus de 90% des
PV et environ 50% des TE et des MFP.
Levine RL, et al., Nature Reviews Cancer, 2007
6
• L’objectif de notre travail, est de rapporter le bilan
d'activité de la recherche de la mutation V617F
JAK2 au niveau de notre établissement hospitalier.
7
8
• Etude rétrospective (multicentrique,
régionale).
• 255 patients
• Mars 2009 - Janvier2012,
• Services d’hématologie de l’Ouest
Algérien.
–
–
–
–
–
–
EHU Oran
CHU Oran
HMRU Oran
CHU Tlemcen
CHU SBA
EPSP de Mascara, Mostaganem, Saïda, Ain
Témouchent, Ain Turk.
9
• Les patients ont été répartis en six groupes de
pathologies en fonction des renseignements
cliniques transmis au laboratoire:
 Polyglobulie primitive ou secondaire
 Thrombocytémie
 SMP atypique
 Splénomégalie myéloïde
 Myélofibrose
 Maladie thrombo-embolique
10
Techniques de génotypage de JAK2
• Extraction d’ADN à partir de 10 ml de sang
total prélevé sur tube EDTA.
• Recherche de la mutation V617F du gène JAK2:
PCR allèle spécifique ou ARMS-PCR (Chen et
al., 2007)
11
Principe de la réaction de PCR
12
CTCTCTCTCACTTTGATCTCCATATTCCAGGCTTACACAGGGGTTTCCTCAGAACGTTGATGGCAG
TTGCAGGTCCATATAAAGGGACCAAAGCACATTGTATCCTCATCTATAGTCATGCTGAAAGTAGGA
GAAAGTGCATCTTTATTATGGCAGAGAGAATTTTCTGAACTATTTATGGACAACAGTCAAACAACA
ATTCTTTGTACTTTTTTTTTTCCTTAGTCTTTCTTTGAAGCAGCAAGTATGATGAGCAAGCTTTC
TCACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTAAGTAAAACTA
CAGGCTTTCTAATGCCTTTCTCAGAGCATCTGTTTTTGTTTATATAGAAAATTCAGTTTCAGGATCA
CAGCTAGGTGTCAGTGTAAACTATAATTTAACAGGAGTTAAGTATTTTTGAAACTGAAAACACTGT
AGGACTATTCAGTTATATCTTGTGAAAAAGGAAAGCAATGAAGTTAAAAGTAGAAGGTTACAATG
CCCAAACAATAGAGTATTA
13
14
463 pb
279 pb
229 pb
15
16
Répartition des patients selon les
établissements hospitaliers
Etablissement hospitalier
Nombre de patients
EHU Oran
112
CHU Oran
62
HMRU Oran
10
CHU Tlemcen
32
CHU de S.B.A
28
EPH de Mascara
2
EPH de Mostaganem
1
EPH de Saïda
3
EPH de Ain Témouchent
2
EPH de Ain Turk
3
Total
255
17
Répartition selon les établissements hospitaliers
CHU SBA, 10.98%
Mostaganem,
0.39%
Mascara, 0.78%
Saida, 1.17%
Ain Témouchent,
0.78%
Ain Turk, 1.17%
EHU Oran, 43.94%
CHU Tlemcen,
12.55%
HMRU Oran, 3.93%
CHU Oran, 24.32%
18
Répartition des patients selon le diagnostic suspecté
SMP suspecté
Nombre
(%)
Polyglobulies (primitive ou secondaire)
94
(36,86)
Thrombocytémies
97
(38,03)
Myélofibrose
05
(1,96)
Splénomégalies myéloïdes
17
(6,66)
SMP atypiques
30
(11,76)
Maladies thromboemboliques
12
(4,70)
Total
255
(100)
19
Répartition selon le Syndrome myéloprolifératif suspecté
Maladies
thromboemboliques
4,70%
Polyglobulies
36,86%
SMP
atypiques
11,76%
Splénomégalie
myéloide
6,66%
Thrombocytémie
38,03%
Myélofibrose
1,96%
20
Résultats du génotypage de JAK2 V617F
SMP suspecté (n)
Nombre de cas
mutés
Prévalence de la
mutation
V617F de JAK2 (%)
Polyglobulies primitives ou secondaires (94)
61
64,89
Thrombocytémies (97)
40
41,23
Myélofibrose (5)
03
60
Splénomégalie myéloïde (17)
05
29,41
SMP atypique (30)
10
33,33
Maladies thromboemboliques (12)
05
41,66
Total (255)
124
48,63
21
Prévalence de la mutation V617F de JAK2
64.89%
60.00%
48.63%
41.23%
41.66%
29.41%
33.33%
22
23
• Notre étude est la première à évaluer la
mutation JAK2 V617F chez des patients avec
un SMP diagnostiqué ou suspecté en Algérie.
• La méthode choisie: rapide, sensible et peu
couteuse.
• Nos résultats confirment que la découverte de
cette mutation a considérablement révolutionné
le diagnostic des SMP.
24
• L’absence de la mutation V617F JAK2 devrait
nous inciter à rechercher d’autres mutations
(mutation du récepteur de Tpo « mutation
W515L», mutations de l’exon 12 de JAK2 …).
• L’utilisation de la mutationV617F JAK2 en tant
que marqueur quantitatif par PCR en temps
réel de suivi de réponse au traitement au cas où
une thérapie ciblée verra le jour.
25
26

similar documents