Document

Report
MOLECULAR BIOLOGY – PCR, sequencing, Genomics
MOLECULAR BIOLOGY TECHNIQUES II.
Polymerase Chain Reacton – PCR
DNA sequencing
MOLECULAR BIOLOGY – PCR
Amplification of specific DNA fragments
Synthetically derived DNA
Cloning and/ or isolation from a genomic library
Both possible but not the most convenient of methods e.g. cost and/ or labour
intensive
MOLECULAR BIOLOGY – PCR
Polymerase Chain Reaction (PCR)
A mechanism to exponentially amplify a specific DNA fragment in a test tube,
using the principles of specific DNA base-pairing and DNA replication and
employing these in repeated cycles
THERMAL CYCLING
• DNA containing fragment to be amplified
(e.g. genomic DNA or cDNA)
• Two oligonucleotide primers (ss) specific to
DNA sequence of desired fragment*
~94oC - Denaturation step
• Purified DNA polymerase (Klenow frag.)
~60oC - Primer annealing step
• deoxyribonucleotide triphosphates (dNTPs)
37oC - Extension step
x25-35
• Buffer solution (with required Mg2+ and K+
cations)
REPEATED THERMAL CYCLING - initiates new rounds of DNA replication
that can use the products of the previous round as template, thus
exponentially amplifying the target DNA fragment
* The oligonucleotide primer sequences must be complementary to DNA sequence flanking the fragment to be amplified and
match with DNA sequence from the opposing strands of that fragment - see next slide
MOLECULAR BIOLOGY – PCR
5’
3’
3’
5’
5’
dsDNA FRAGMENT TO BE AMPLIFIED
EXTENSION -
37oC
DENATURATION 94°C
(Klenow)
3’
DNApol
primer
primer
ANNEALING ~60oC
DNApol
3’
5’
DENATURATION
5’
3’
DENATURATION
3’
5’
DENATURATION
With each repeated THERMAL CYCLE (denaturation, annealing & extension) the amount of target dsDNA doubles
MOLECULAR BIOLOGY – PCR
PCR’s DNApol problem !
Primitive PCR machine (3 water baths)
DNApol (Klenow fragment) is killed by the heat
THERMAL CYCLING
INITIAL DENATURATION
DENATURATION
ANNEALING
e.g. x30
EXTENSION
94oC
60oC
37oC
TERMINAL EXTENSION
Expensive Klenow had to be added after every thermal cycle !
Yellowstone National Park Thermal Springs
Isolation of thermophillic bacteria:
Thermophillus aquaticus (50-80oC)
Has an extremly heat stable (t1/2 >40 mins at
95oC) DNA polymerase
Taq polymerase ideally suited to PCR!
MOLECULAR BIOLOGY – PCR
Thermostable DNA polymerases and PCR
The isolation of Taq polymerase permitted the automation of PCR
thermal cycling as fresh DNApol did not need to be added after every
cycle !
HOWEVER: Taq polymerase lacks a proofreading activity (3‘-5‘
exonuclease) and high error rate
DNA polymerase
Klenow
Taq polymerase
Pfu polymerase
error rate (misincorporated nucleotide)
1: 50 000
1: 9 000
1: 1 300 000 ! ! !
Stratgene inc. isolated a DNA polmerase from the hyperthermophilic
archae (primitive bacteria) Pyrococcus furiosus found in the marine
sediment associated with ocean thermal vents
Pfu polymerase is extremely heat stable (Pyrococcus furiosus optimum
growth temperature is 100oC)
Crucially Pfu polymerase has proof-reading activity and has the lowest
error rate of any known thermostable polymerase
Pfu polymerase is IDEALLY suited for PCR applications where high
fidelity amplification of DNA is required (although more expensive than
Taq polymerase)
MOLECULAR BIOLOGY – PCR
A typical PCR protocol
Template DNA, sequence specific
sense and antisense
oligonucleotide primers, thermostable DNApol (e.g. Taq or Pfu),
dNTPs & PCR buffer
STEP
TEMP
INITIAL DENATURATION 94-96oC
TIME
NOTES
2-3 mins.
ensures all template DNA is single stranded (some DNApol
require ‘hot-start’ for activation e.g. Pfu)
DENATURATION
94-96oC
0.5-2 mins.
longer denaturation will ensure more single stranded DNA
and better efficiency at cost of enzyme stability
ANNEALING
~60oC
0.5-2 mins.
Higher temperature increase product specificity (less
chance of mismatches forming) but lowers potential yield.
15-25oC < melting temperature Tm of annealed primer
EXTENSION
~72oC
~1 min/kb
Taq processivity = 150 nucleotide per second (Pfu slower)
TERMINAL EXTENSION
~72oC
5-10 mins.
Allows any incomplete products get finished
x25-30
MOLECULAR BIOLOGY – PCR
‘Invention’ of PCR
KARY B. MULLIS
Journal of Molecular Biology
Volume 56, Issue 2 , 14 March 1971, Pages 341-361
Studies on polynucleotides
XCVI. Repair replication of short synthetic DNA's
as catalyzed by DNA polymerases
K. Kleppe‡, E. Ohtsuka§, R. Kleppe‡, I. Molineux|| and H. G. Khorana||
Institute for Enzyme Research of the University of Wisconsin, Madison, Wisc. 53706, U.S.A.
Received 20 July 1970.
Cetus Corporation
1983 PCR discovery
1985 published,
patent pending
1987 patented
1993 Nobel prize
Dr. Kjell Kleppe
H.G. Khorana
Mullins would have been ‘aware’ of the work of Kleppe and
Khorana. Although their method did not amplify DNA it is
generally accepted their research was a ‘primer’ for PCRs
discovery
MOLECULAR BIOLOGY – PCR
‘Polymerase chain reaction (PCR)’
amplification of DNA - video/ tutorial
http://www.sumanasinc.com/webcontent/animations/content/pcr.html
MOLECULAR BIOLOGY – PCR
Experimental uses of PCR
Introduction of specific and useful DNA sequences
Sequence specific (i.e. complementary) DNA oligonucleotide
primer with non-complementary yet useful 3’ sequence
PCR
Incorporation of useful DNA sequence into PCR product
EPITOPE TAG
Generation of restriction
enzyme sites for cloning
Addition of extra protein coding DNA sequence for
a ‘tag’ that can be used experimentally to detect or
purify a protein
MOLECULAR BIOLOGY – PCR
Experimental uses of PCR
Introduction of specific mutations within recombinant DNA ‘directed mutagenesis’
Mutagenic primer
T
5‘ TGCTGTGATGT GCTGATGCTGAATGC 3‘
3‘ CGCACGACACTACATCGACTACGACTTACGACGCTACAAGTTCATGAC 5‘
R T T L H R L R L T T L Q V H D
Q
Protein coding DNA sequence (cDNA)
MOLECULAR BIOLOGY – PCR
Experimental uses of PCR
Degenerate PCR
MOLECULAR BIOLOGY – PCR
Experimental uses of PCR
Nested PCR: two rounds of consecutive PCR using a second pair of primers with annealing sites
within the products produced by the first pair of primers
Some DNA fragments can sometimes be difficult to amplify by PCR - (potential secondary
structures or spurious products arising from primers binding other on-target DNA). Nested PCR
will increase the yield of true target DNA
MOLECULAR BIOLOGY – PCR
Experimental uses of PCR
Detecting SNPs by PCR
GCTGTGATGTAGCTGATGCTGAATG
3’TCGATCGCACGACACTACATCGACTACGACTTAAGACGCTACAA’5
SNP-specific primer
amplification
GCTGTGATGTAGCTGATGCTGAATGCTGCGATGTT
3’TCGATCGCACGACACTACATCGACTACGACTTACGACGCTACAA’5
SNP
Detection of SNPs is important for:
• diagnosing certain genetic diseases arising from ‘point mutation’ e.g. sickle cell anaemia (Hb
gene E6V)
• identifying linkage traits e.g. SNPs in the Apolipoprotein E are associated with increased risk of
Alzheimer’s diseas
MOLECULAR BIOLOGY – PCR
Inverse PCR
DNA digested with restriction enzyme not
cutting in known region
A method to amplify a particular DNA region
(e.g. containing a gene) with only partial
sequence information
N.B. relies on being able to cut DNA with
‘restriction’ enzymes that only cut at specific
DNA sequences - see lecture 8
Generated compatible ends are ligated into a circle
DNA re-linearised by
digestion with a
restriction enzyme
recognising a site
within the know
sequence
PREVIOUSLY UNKNOWN
DNA SEQUENCE CAN BE
DETERMINED BY
SEQUENCING FROM
KNOWN FLANKS
Unknown DNA
can know be
PCR amplified
using primers
specific to the
known sequence
Unknown DNA can know be PCR amplified using
primers specific to the known sequence at each end
DNA SEQUENCE WILL REVEAL WHERE UNKNOWN FRAGMENTS WHERE ORIGINALLY LIGATED (i.e. LEFT AND RIGHT)
MOLECULAR BIOLOGY – PCR
MICROSATELLITE SEQUENCES
Sequence repeats:
(A)n
(CA)n
(CAG)n
(CAGT)n
Variable Number of Tandem Repeats (VNTR)
a
5’
3’
3’
5’
b
5’
3’
3’
5’
AFLP – amplified fragment length polymorphism
DNA fingerprinting
MOLECULAR BIOLOGY – PCR
Experimental uses of PCR
Reverse Transcription PCR (RTPCR)
mRNA
5’ CCGAGTAGCTAGGAACTGATGAATGTCGATCGCACGACACTACATCGACTACGACTTAAGACGCTACAATCGATCGCACGACACTACATCG
ACTACGACTTACGACGCTACAATTGAGGTCGATGA...CCCCATGAGGGTGTGACCCGACATGACATGACATTGAGGCACAAATCAATGTA
3’
GAAAAAAAAAAAAAAAAAAAAAAAAAA
TTTTTTTTTTT
Reverse transcription
cDNA
5’ TTTTTTTTTTTTTTTTTTTTTTTTTCTACATTGATTTGTGCCTCAATGTCATGTCATGTCGGGTCACACCCTCATGGGG. . .
TCATCGACCTCAATTGTAGCGTCGTAAGTCGTAGTCGATGTAGTGTCGTGCGATCGATTGTAGCGTCTTAAGTCGTAGTCGATGTAGTGTC
G
3’
Normal PCR
TGCGATCGACATTCATCAGTTCCTAGCTACTCGG
Presence of DNA product reveals presence of mRNA in the original sample
However, more quantitative rather than qualitative results maybe required
MOLECULAR BIOLOGY – PCR
Real-time PCR (Quantitative PCR or Q-PCR)
product
General PCR kinetics
1.
2.
Plateau due to exhaustion of
reagents
Measurements of abundance
must be taken in the exponential
phase of the PCR
PCR cycles
If the number of PCR cycles used were not in the
exponential phase, one could mistake samples 1.
and 2. of being of equal concentration
Continuous measurement of product synthesis would be preferable i.e
measurements in ‘real time’
MOLECULAR BIOLOGY – PCR
Real-time PCR (Quantitative PCR or Q-PCR)
SYBR green-based Q-PCR assay
• ds DNA intercalating dye
• fluoresces green under blue light
• only emits fluorescence when bound to
double stranded DNA
Under PCR cycling conditions
denaturation
annealing
SYBR green fluorescence can be measured at
the end of either the annealing* or extension
steps after every PCR cycle and used to
calculate the amount of DNA in the sample
extension
* Measurements usually taken at the end of the primer annealing step
MOLECULAR BIOLOGY – PCR
‘Real-time PCR (Q-PCR)’ using SYBR
green-based assay - video/ tutorial
click on this link
http://www.appliedbiosystems.com/absite/us/en/home/applications-technologies/real-time-pcr.html
MOLECULAR BIOLOGY – PCR
Real-time PCR (Quantitative PCR or Q-PCR)
Fluorescent hybridisation probe based methods (e.g. TaqMan probes)
DNA sequence complementary to DNA
sequence of target molecule
+ other PCR reagents
Fluorescent
reporter group
Fluorescence quencher
At each ANNEALING step, probe and primers
hybridises with target/ product DNA
Molecular proximity of quencher prevents
reporter fluorescence
During EXTENSION step the annealed probe is
digested by Taq DNApol (5’ - 3’ exonuclease activity)
Reporter fluorescence no longer quenched and
used to quantify the DNA present
MOLECULAR BIOLOGY – PCR
‘Real-time PCR (Q-PCR)’ using
fluorescent molecular probes - video/
tutorial
http://www.biosearchtech.com/support/videos/realtime-pcr-probe-animation-video.aspx
http://www.scanelis.com/webpages.aspx?rID=679
MOLECULAR BIOLOGY – sequencing
DNA SEQUENCING
(i.e. determining the order of the four possible deoxynucleotides in one of
the DNA strands and by inference the order on the other strand)
MOLECULAR BIOLOGY – sequencing
Dideoxynucleotide trisphosphate chain terminator/ Sanger DNA sequencing
DNA backbone comprises phosphodiester bonds between the
5’ and 3’ carbon atoms of the deoxyribose moeities of
consecutive deoxynucleotides
Addition of an additional deoxynucleotide to a growing DNA
strand, during DNA synthesis, requires a free 3’-OH group
However, incorporation of a chemically modified
dideoxynucleotide (ddNTP), lacking a 3’-OH group,
would prevent additional polymerisation and hence
TERMINATE DNA synthesis
Sanger realised such ‘chain termination’ could be exploited to reveal the sequence of a
specific/ target DNA molecule, but how?
MOLECULAR BIOLOGY – sequencing
Dideoxynucleotide trisphosphate chain terminator/ Sanger DNA sequencing
DNApol
ddGTP is
radioactively labelled
5’-CTGGGATACTGTACTAGC-3’
3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’
5’-CTGGGATACTGTACTAGCACTTAACCTTTG
3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’
5’-CTGGGATACTGTACTAGCACTTAACCTTTGATCG
3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’
dGTP
ddGTP
dTTP
dATP
5’-CTGGGATACTGTACTAGCACTTAACCTTTGATCGATCTAG
3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’
5’-CTGGGATACTGTACTAGCACTTAACCTTTGATCGATCTAGCCG
3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’
dCTP
Target DNA, oligonucleotide
primer & DNApol
Generation of a series of differently sized fragments
synthesised from the target DNA molecule that all end with
radio-labelled dideoxy-G (specified by C in the target DNA)
MOLECULAR BIOLOGY – sequencing
Repeat reaction using the three other radio-labelled ddNTPS
G
A
T
dGTP
dGTP
dGTP
ddGTP
dTTP
dATP
dCTP
Target DNA,
oligonucleotide primer &
DNApol
ddATP
dTTP
dATP
dCTP
Target DNA,
oligonucleotide primer &
DNApol
ddTTP
dTTP
dATP
dCTP
Target DNA,
oligonucleotide primer &
DNApol
C
dGTP
ddCTP
dTTP
dATP
dCTP
Target DNA,
oligonucleotide primer &
DNApol
Now have a complete population of varying length DNA fragments (at one base-pair resolution),
derived from target DNA, that end with one of four radio-labelled dideoxynucleotides
MOLECULAR BIOLOGY – sequencing
G
A
T
C
ACTTAACCTTTGATCGATCTAGCCG
ACTTAACCTTTGATCGATCTAGCC
ACTTAACCTTTGATCGATCTAGC
ACTTAACCTTTGATCGATCTAG
ACTTAACCTTTGATCGATCTA
ACTTAACCTTTGATCGATCT
ACTTAACCTTTGATCGATC
ACTTAACCTTTGATCGAT
ACTTAACCTTTGATCGA
ACTTAACCTTTGATCG
ACTTAACCTTTGATC
ACTTAACCTTTGAT
ACTTAACCTTTGA
ACTTAACCTTTG
ACTTAACCTTT
ACTTAACCTT
ACTTAACCT
ACTTAACC
ACTTAAC
ACTTAA
ACTTA
ACTT
ACT
AC
A
+
polyacrylamide
DNA sequencing
gel
autoradiography
film
Read off DNA sequence from bottom
to top (5’-3’ on newly synthesised
strand). Reverse complement for the
other strand
MOLECULAR BIOLOGY – sequencing
‘Dideoxynucleotide trisphosphate
chain terminator/ Sanger DNA
sequencing’ principle - videos/
tutorials
http://spine.rutgers.edu/cellbio/assets/flash/dideoxy.htm
http://smcg.cifn.unam.mx/enp-unam/03EstructuraDelGenoma/animaciones/secuencia.swf
MOLECULAR BIOLOGY – sequencing
Automation of the Sanger DNA sequencing method using fluorescently
labelled ddNTPs
Each ddNTP varient is conjugated to a specific fluorescent group
(ddGTP, ddCTP, ddATP and ddTTP) allowing the 4 reactions to be
pooled in one tube and the electrophoresed in the same lane
The specific fluorescence signature of each band informs which
nucleotide is at that position in the target DNA
Process can be highly automated using ‘capillary tube
electrophoresis’ coupled to automatic fluorescence detectors
(~1Kb max)
Automatic DNA sequence analyzers
Principle of automated DNA sequencing
detector
capillary electrophoretic tubing
MOLECULAR BIOLOGY – sequencing
How to sequence a human genome - video/
tutorial
Featuring a description of automated fluorescence based DNA sequencing
http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTDV026689.htm
MOLECULAR BIOLOGY – PCR, sequencing
Why not try to deduce the sequence of larger
segments of DNA . . .
Genes . . .
Chromosomal regions . . .
Whole Chromosomes . . .
Entire genomes?
MOLECULAR BIOLOGY – PCR, sequencing
1990 Human Genome Project
(HGP)
Complete sequencing of the whole human genome within 15 years
MOLECULAR BIOLOGY – PCR, sequencing
Whole Genome Shotgun DNA Sequencing
Human genome (blood donors)
Isolation of genomic DNA
Cloning of the genomic DNA fragments
(i.e. to build a genomic DNA library;
consisting of BACs - 200Kb)
Mapping BACs to known sequence
markers (i.e. identify from what part
of the genome does the BAC come
from)?
MOLECULAR BIOLOGY – PCR, sequencing
Whole Genome Shotgun DNA Sequencing
Mapped BACs (i.e. in correct order on
chromosome)
Fragmentation of BAC clones
and BAC sub-clone libraries
(typically cloned into
bacteriophage; ~2Kb)
Sanger-based sequencing of
the sub-clones (from either
end)
Sequence alignment of overlapping sequences
from various subclones to reconstitute the
entire BAC DNA sequence
MOLECULAR BIOLOGY – PCR, sequencing
Whole Genome Shotgun DNA Sequencing
Repeated iterations of sub-clone sequencing (to give sequence depth i.e.
confidence) and BAC reconstitution, for all the BACS covering the entire
genome.
Publication of a draft sequence in 2000 and a complete sequence in 2003
!
Human genome rich
in repetitive sequences:
???
AAAAAAAAAAAAAAAAAAAAAAAA
GTCCTGCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAGCTTGGCTCACATAGT
J. Craig Venter
Francis Collins
President William J. Clinton
Now many hundreds of different
species’ genomes have been
shotgun sequenced
MOLECULAR BIOLOGY – PCR, sequencing
The politics of sequencing the human genome !!!
Founded as an international publicly funded consortium effort to sequence all
the bases of the human genome with 15 years at a cost of $3 billion
Aimed to provide free and open
access to all the data as a
resource for research biologists
During the 1990’s a number of groups had placed patents on genes that they
had cloned, setting a commercial precedent/ incentive to whole genome
sequencing
MOLECULAR BIOLOGY – PCR, sequencing
J. Craig Venter – founder of ‘CELERA Genomics’
1998 launched a commercial bid to sequence human genome and secure gene patents
$$$$$
Thus, the start of a race to publish the complete genome sequence between Celera and the
publicly funded HGP begun. It was eventually decided that patents on genes were not legal
but both projects ended up publishing at the same time
MOLECULAR BIOLOGY – PCR, sequencing
How the genome was ‘won’ for all
of humanity and not for ‘profit’ !
Storage of the human genome DNA sequence (3.3
billion base-pairs)
3300 books of 1000 pages with 1000 bp
per page
1 data CD (786 Mb; 2bits per bp)
MOLECULAR BIOLOGY – Genome sequencing
How to sequence a human genome by
shotgun sequencing - video/ tutorial
http://www.genome.gov/19519278#al-3
MOLECULAR BIOLOGY – PCR, sequencing
NEXT GENERATION DNA SEQUENCING (NextGen DNASeq)
Ultra high throughput with many millions of sequence reads per reaction allowing genomic scale
experimentation analysis in single experiments!
Examples of NextGen DNASeq technologies
• Illumina (Solexa) sequencing
• Ion semiconductor sequencing (e.g. Ion Torrent)
• Lynx Therapeutics' Massively Parallel Signature Sequencing (MPSS)
• Polony sequencing
• 454 pyrosequencing
• SOLiD sequencing
• Ion semiconductor sequencing (e.g. Ion Torrent)
• DNA nanoball sequencing
• Helioscope(TM) single molecule sequencing
• Single Molecule SMRT(TM) sequencing
• Single Molecule real time (RNAP) sequencing
• Nanopore DNA sequencing
• VisiGen Biotechnologies approach
MOLECULAR BIOLOGY – PCR, sequencing
Illumina based DNA sequencing
DNA or
cDNA
DNA sample
preparation
Adapters ligated to ends of fragmented (~300bp) DNA
sample
2-step process:
1.
ligation of the same oligonucleotides to
both ends
2. PCR based amplification, adding unique DNA
sequence at each end (i.e. pink and blue in
figure)
Specific DNA sequence adapters
Sample DNA
attachment to flow
cell surface
Sample DNA adapters base-pair with
complementary oligos fixed to the surface of the
flow cell (pink or blue)
The sample DNA is therefore primed for copying
resulting in a copy of the sample DNA being
immobilised to the flow cell surface (the original
sample DNA is washed away)
MOLECULAR BIOLOGY – PCR, sequencing
Illumina based DNA sequencing
The adapter sequences (pink or blue) at the free
end of the immobilised copies of the sample
DNA are free to base-pair with other
neighbouring oligos that are fixed to the
surface of the flow cell
Bridge amplification
Such ‘bridge’ interactions prime another round of
DNA copying,
The result is two complementary copies of the
original sample DNA being immobilised to the
slide in proximity to each other
MOLECULAR BIOLOGY – PCR, sequencing
Illumina based DNA sequencing
Repeated cycles of bridge amplification lead to
the generation of copied complementary
clusters of the original sample DNA
Cluster formation
The cluster contains copies of both strands of the
original DNA (i.e. it’s complementary).
Therefore prior to cluster sequencing one
strand is removed by cleaving with a
restriction enzyme that recognises a
sequence within either the pink or blue
adapter.
The flow cell surface is covered in several million
dense clusters - all representing one
original DNA molecule in the sample
Actual sequence reaction utilizing ‘reversible chain terminator
fluorescent dNTPs’
MOLECULAR BIOLOGY – PCR, sequencing
Illumina based DNA sequencing
A mix of sequencing primers (complementary to
one of the adapter sequences), DNA
polymerase and differentially fluorescent
labelled reversible chain terminator dNTPs
(A, C, T and G) are added to flow cell
Sequencing DNA
clusters one base
at a time
Depending on the first nucleotide in the cluster, a
specific fluorescent reversible chain
terminator dNTP is incorporated leading to
a stop in DNA synthesis!
After washing unincorporated nucleotides away,
a laser excites the flow cell and detects
which of the four fluorescent chain
terminator dNTPs were incorporated in each
cluster on the flow cell. i.e. decodes the first
sequenced base
Once an image recording what was the first nucleotide to be
incorporated in each cluster has been taken, both the
fluorescent dyes and the blocking group that prevents
extension of the DNA are removed (hence ‘reversible chain
terminator dNTPs) and the cycle is repeated
MOLECULAR BIOLOGY – PCR, sequencing
Illumina based DNA sequencing
Sequential
sequencing rounds
one base at a time
Possible to get up to 50 base-pairs of good
sequence but there are millions of different
clusters!
MOLECULAR BIOLOGY – PCR, sequencing
The principles of ‘illumina-based’ next
generation based sequencing - video
http://www.illumina.com/technology/sequencing_technology.ilmn
MOLECULAR BIOLOGY – PCR, sequencing
The principles of ‘illumina-based’ next
generation DNA sequencing - video
http://www.youtube.com/watch?v=77r5p8IBwJk
ION PERSONAL GENOME MACHINE SEQUENCER
NextGen DNASeq Ion Torrent - video/
tutorial
http://lifetech-it.hosted.jivesoftware.com/videos/1016
MOLECULAR BIOLOGY – PCR, sequencing
Craig Venter Institute
Sorcerer II expedition
MOLECULAR BIOLOGY – PCR, sequencing
„Our researchers discovered at least 1,800 new species and more than
1.2 million new genes from the Sargasso Sea“
Intensive horizontal gene transfer

similar documents