PPT - International Wheat Genome Sequencing Consortium

Report
The IWGSC:
Strategies & Activities to Sequence
the Bread Wheat Genome
Kellye A. Eversole
IWGSC Executive Director
&
The IWGSC
Wheat Breeding 2014: Tools, Targets, & Progress
Harpenden, United Kingdom
29 January 2014
The International Wheat Genome Sequencing
Consortium
Launched in 2005 on the initiative of Kansas Growers
Executive director
K. Eversole
Co-chairs
R. Appels
J. Dvorak
C. Feuillet
B. Gill
B. Keller
Y. Ogihara
General members
Coordinating
Committee
Sponsors
Why
Vision
• Lay a foundation to accelerate wheat improvement
• Increase profitability throughout the industry
• High quality annotated genome sequence,
comparable to rice genome sequence
• Physical map-based, integrated and ordered sequence
Wheat Improvement is Complex
 Yield potential and yield stability
 Adaptation to climate change
 Durable resistance to biotic stress
 Quality of grain and co-products
Training, capacity building
-> expertise and critical mass
Complexity Requires an Integrated Toolbox
Gene and
QTL
mapping
Map-based
cloning
Candidate
genes
Perfect
markers
Allele mining
Improved wheat varieties
Managing the 17 Gb, Hexaploid Genome
AA
BB
Triticum aestivum
(2n = 6x = 42)
1C ~ 17,000 Mbp
DD
Dissection of the genome into single
chromosomes (arms)
Sheath fluid
D
Flow
chamber
Fluorescence
emission
Laser
Excitation
light
B
A
Deflection
plates
Scattered
light
;
Waste
Doležel et al., Chromosome Res. 15: 51, 2007
 Chromosomes: 605 - 995 Mbp
(3.6 – 5.9% of the genome)
 Chromosome arms: 225 - 585 Mbp
(1.3 – 3.4% of the genome)
Chromosome genomics
 Chromosome specific BAC libraries and sequencing
IEB
Faster and cheaper methods to tackle the wheat genome
http://flxlexblog.wordpress.com/2012/12/03/developments
-in-next-generation-sequencing-a-visualisation/
Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI
www.genome.gov/sequencingcosts.
A sequence for whom & for what purposes
Feuillet et al, TIPS, 2010
BAC by BAC vs WGS
BAC by BAC (physical map)
√
TEs
Genes
Whole genome
shotgun
500 kb
IWGSC Strategy for a Reference Wheat Genome Sequence
1. BAC library construction
2. BAC fingerprinting (HICF/WGP)
GAATTCTTGGTCAGCAATAAGGACAAAGAA
GAATTCCTCCTGTGCGGCCGTTTTA
GAATTCATGCTCCAGCCAACTCATCCAAAA
GAATTCAACAATATAAATATCACCTAAAGC
GAATTCCATCAGTATGGAGTTTCTTCATGC
GAATTCAAGCTTGAGTATTCTATAGTGTCA
GAATTCAATATGTAGAAATTATAGGATGGC
GAATTCACCGGAAGGGGTTCCGGGTGTTTC
GAATTCCGGAACGCTTCCGGAGACCAAACA
GAATTCTGGAATCACTTGATGATGAATCAG
GAATTCTGGAGTCTTCCTTTCCGCAGCGAA
GAATTCAACGAAATAGTTATGAAATAGAAG
GAATTCTGGGGTAACGATGGAATCCTACAC
GAATTCTGTCAACGACACTATCATCAGGAA
GAATTCTTCGATGCACTGAGTCGCACGGTT
GAATTCTTGTGTGAGGTCCGCGTCCTAGAT
3. Contig assembly by FPC/LTC
4. MTP sequencing /Scaffold assembly
5. Pseudomolecule construction
(meiotic/LD/RH mapping)
6. Automated and curated annotation
SNP1
SNP2
SNP3
SNP4
SNP5
SNP6
SNP7
SNP8
SNP9
SNP10
Roadmap to the Wheat Genome Sequence
Physical mapping of individual
chromosomes
Short term
MTP sequencing
Long term
Survey sequencing of individual
chromosomes
Gene catalog
Virtual order
Markers
A reference sequence anchored to the genetic and
phenotypic maps
Current status of individual projects
Physical
maps
Illumina
Survey
sequences
Pseudomolecules
IWGSC Chromosome Survey Sequencing Initiative
Amplified
DNA- sorted
individual
chromosomes
~50X
Illumina
sequence
Chromosome
arm sequence
assemblies
A, S, D, &
AB genomes
(7)
>30X
Illumina
sequence
Read/assembly
alignment to
chromosome
arms
Gene modeling,
virtual ordering
(GZ),
annotation,
functional,
structural
analyses
Composition
and Evolution
of the 21 Bread
Wheat
Chromosomes
IWGSC Chromosome Summary
Survey Sequencing - Summary
• Almost full wheat gene complement identified and
allocated to chromosome arms
• On average, 53% of genes virtually ordered along
chromosomes
• High level of inter- and intrachromosomal
duplication
• Over 3.5 M markers mapped to contigs (1.3M wheat
markers + 2.3M SNPs) - SSR, EST, DArT, SNP (90k)
markers...
• 13.2 million SNPs from POPSeq aligned to contigs
IWGSC CSS Resources are Facilitating
• New phylogenetic analyses of wheat genome
evolution
• Definition of core and pan gene sets for
Triticeae by comparing di-tetra- and hexaploid
genomes
• Homoeologue-specific gene expression analyses
• Wheat haplotype map – E. Akhunov
• TILLING projects in T. durum and bread wheat –
UC, Davis, JIC, Rres
• Establishment of WheatNet – UC, Davis
3B SEQuencing Project
Chr 3B physical map
1,282 BAC-contigs
8,441 BACs
Pool of 10 BACs
Sorted chr. 3B
(Roche 454 GSFLX Titanium, 8 Kb MP)
922 pools
(~35X)
BAC pool
Illumina (82X)
454 scaffolds
Sanger
Illumina contigs
BAC-ends
(2*600 bp)
Super-scaffolds
3B pseudomolecule assembly
and analyses
Catherine Feuillet & Fred Choulet
(2*108 bp)
PE 0.5 kb
An integrated and ordered 3B reference sequence
MetaQTL analysis
3B consensus map (5000 markers)
3B Physical map
3B pseudomolecule
Map-based cloning projects on 3B
40 genes and QTL mapped on 3B
4722 markers on 3B consensus map, 3102 in 964 SC (679 Mb =82 % of the
sequence)
13 map-based cloning projects








Disease resistance genes (Sr, Lr, Yr, Stb…)
Solid stem (saw fly)
Yield
Drought tolerance
Boron transporter
Flowering time
NUE
Chromosome pairing…
Curtis Pozniak
A Breeder’s Perspective
SSt1
3B Physical
SSt1
3BL
Xgwm114
XBE200774
XPSP3001
SSt1
Xgpw4513
Xgwm340
Xgwm247
Xgwm181
Xgwm114
Xfba217
XBE200774
ctg580
ctg854
Xgwm4703
ctg668
Xwmc274
ctg165
Xgwm247
Xgwm340
Xtam63
Xfba310
Xfba133.2
Xfbb293
Xdarts149
Xgwm181
Xgwm547
Xbarc68.2
Xgpw4513
1 year
-1 EST marker, not closer
- ascertainment bias
0.0
3.2
6.5
7.2
9.3
10.7
14.1
15.1
16.2
21.5
gwm114
9K_0808_ck
PSP3001
EI_02_115946
EI_01_145834
EI_05_46657
EK_02-210770
EK_02-276963
EK_03-83684
EK_03-59414
SSt1
EK_08-5169
EK_02-239361
EK_02-21792
EK_03-83026
BF200774
gwm340
gpw4513
gwm247
Xgwm181
3 weeks
-12 cosegregating markers (SNPs)
- no phenotyping in the fields
- No ascertainment bias
Speed Gene Discovery:
Towards Cloning SSt1
B
Fine map
C
3B Pseudomolecule
A High-density map
EI_05-46657
EI_05-46657
10.6
EK_08-5169
XBF200774
EK_08-5169
XBF200774
EK_02-239361
EK_02-292495
SSt1
EK_02-239361
EK_02-292495
2.8 cM
SSt1
12.6
Approx. 2.2 Mb
Ctg1109-90254
13.3
15.3
Xgwm247
16.6
Xgwm247
4000 Kbp
Power of A High Quality Reference Sequence
Number of QTLs Cloned
Rice
Wheat
Feuillet et al, Trends in Plant Sciences, 2010; Rey et al, unpublished update)
Wheat Sequences Available Now
WCS
WGS
CS WGS 5x
(2012)
A and D genome
related ancestors
(2013)
CS chromosome
survey sequences
(2013)
Max 50% using synteny and genetic mapping (GZ): « virtual order »
MTP
CS 3BSEQ
(2013)
94% real order
Gold
completeness of information standard
5X CS
Applications
« blind » SNP marker
development
x
Ae.
T.
tausc urartu
hii
x
x
Targeted SNP marker
development
45%
Map-based cloning time
(years)
10
MTP
based (3B)
x
x
Conversion rate in
genotyping for breeding
Fundamental studies
CS
CSS
x
95%
10
10
8
limited to genes
2
complete
IWGSC Projects
The Annotated Reference Sequence
of the Bread Wheat Genome
Pseudomolecules
(1 of 21 completed)
Chromosome Shotgun Sequences
and marker alignment
(completed)
Physical Maps with markers
(12 of 21 completed)
Curtis Pozniak
IWGSC Resources in Breeding
BAC Libraries
Physical Maps
Wheat Survey
Sequence
3B Sequence
• Unlimited source of DNA
markers for MAS/Genomic
Selection
• Candidate genes for traits =
perfect markers
• Reduce the time and improve
the success of resolving QTL
• Discovery and exploitation of
new alleles
IWGSC Resource Access
• All resources accessible at URGI, Versailles
http://wheat-urgi.versailles.inra.fr/Seq-Repository/
• Raw sequence reads in the SRA
• IWGSC CSS assemblies available at URGI and EBI
• IWGSC CSS assemblies & gene models integrated into EnsemblPlants
http://plants.ensembl.org/Triticum_aestivum


272 institutions
40 countries
 52,000 BLAST searches
 2.500 downloads
Thank you for your attention!
www.wheatgenome.org
@wheatgenome

similar documents