Essential Amino Acid Biosynthesis in Acanthamoeba spp.

Report
Essential Amino Acid
Biosynthesis in
Acanthamoeba spp.
Christopher Rice
Supervisor: Dr. Fiona Henriquez
o Acanthamoeba spp. are free living amoeba
o Ubiquitously found and opportunistic protozoan parasites
o Causes Acanthamoeba keratitis (AK) in Immunocompetent individuals
o AK is a vision threatening disease of the cornea
o Associated with contact lens wearers
o 125 million people wear contact lenses world wide
o 1 in 30,000 people in the UK are infected
o Current treatments are ineffective and can cause
encystment of Acanthamoeba
o Recurrent infections are caused by these cysts excysting
Figure 2. re-infection caused by Acanthamoeba.
Strain
Isolated
Acanthamoeba castellanii
Pond, Golden Gate Park, San
Neff
Francisco
Acanthamoeba castellanii Clinical isolate in Ancona, Italy
Clinical T4
Acanthamoeba polyphaga Clinical isolate in Houston, Texas
ATCC 50371
Acanthamoeba castellanii
Clinical isolate in New York
ATCC 50370
Contents
o Characterisation of the histidine biosynthesis pathway in
Acanthamoeba spp.
o Inhibition by targeting Imidazoleglycerol-phosphate
dehydratase (IGPD)
o Identification of the lysine biosynthesis pathway in
Acanthamoeba spp.
o Inhibition by targeting Homoisocitrate dehydrogenase
(HIcD)
Contents
o Characterisation of the histidine biosynthesis pathway in
Acanthamoeba spp.
o Inhibition by targeting Imidazoleglycerol-phosphate
dehydratase (IGPD)
o Identification of the lysine biosynthesis pathway in
Acanthamoeba spp.
o Inhibition by targeting Homoisocitrate dehydrogenase
(HIcD)
ATP + 5-phosphoribosyl 1-pyrophosphate
Histidine
biosynthetic
pathway
ATP phosphoribosyltransferase
Phosphoribosyl-ATP
Phosphoribosyl-ATP pyrophosphatase
Phosphoribosyl-AMP
Phosphoribosyl-AMP cyclohydrolase
PhosphoribosylformiminoAICAR-phosphate
Phosphoribosyl-5-amino-1- phosphoribosyl-imidazole
carboxamide isomerase
Phosphoribosylformimino-AICAR-P
AICAR
Imidazoleglycerol phosphate synthase
D-erythro-inidazole-glycerol-phosphate
Imidazoleglycerol-phosphate dehydratase (IGPD)
Imidazole acetol-phosphate
Histidinol-phosphate aminotransferase
L-histidinol-phosphate
Histidinol phosphatase
L-histidinol
Histidinol dehydrogenase
L-histidinal
Histidinol dehydrogenase
Histidine
Molecular biology
o Using Histidine deficient media wean the cells from rich media
into deficient media only from 50% to 80% then 100%
o Force Acanthamoeba to produce these amino acids through their
biosynthesis pathways (if possessed)
o Once growing in 100% deficient media 2x106 cells are used for
RNA extraction
o cDNA is then synthesised from the RNA
o Using molecular techniques, PCR amplification of the gene
through these biosynthesis pathways using specific primers
designed from other species aligned to Acanthamoeba contigs
from Baylor College of medicine
o Acanthamoeba RNA seq has been released by Clark et al. 2013
Primer name
Sequence
Sequence
size
HisB exp for
ATGGAAAAGAGGGAGGCACAGGTGG 25
HisB exp rev
TCACTCGAGTACGCCCTTGGTGC
23
o Acanthamoeba have been found to grow in histidine deficient media
signifying that the Histidine biosynthesis pathway is present
o Imidazoleglycerol-Phosphate Dehydratase (IGPD) the sixth enzyme
within the histidine pathway has been amplified and there are known
drug inhibitors
o 3-amino-1, 2, 4-triazole (3AT) trade name Amitrole, known to block root
elongation and irreversible inhibitor of catalase in plants
o 3AT is also a competitive inhibitor of IGPD and also a non selective
systemic herbicide
ATP + 5-phosphoribosyl 1-pyrophosphate
The histidine
biosynthetic pathway
ATP phosphoribosyltransferase
Phosphoribosyl-ATP
Phosphoribosyl-ATP pyrophosphatase
Phosphoribosyl-AMP
Phosphoribosyl-AMP cyclohydrolase
PhosphoribosylformiminoAICAR-phosphate
Phosphoribosyl-5-amino-1- phosphoribosyl-imidazole carboxamide
isomerase
Phosphoribosylformimino-AICAR-P
AICAR
Imidazoleglycerol phosphate synthase
D-erythro-inidazole-glycerol-phosphate
3AT
Imidazoleglycerol-phosphate dehydratase (IGPD)
Imidazole acetol-phosphate
Histidinol-phosphate aminotransferase
L-histidinol-phosphate
Histidinol phosphatase
L-histidinol
Histidinol dehydrogenase
L-histidinal
Histidinol dehydrogenase
Histidine
ATP + 5-phosphoribosyl 1-pyrophosphate
The histidine
biosynthetic pathway
ATP phosphoribosyltransferase
Phosphoribosyl-ATP
Phosphoribosyl-ATP pyrophosphatase
Phosphoribosyl-AMP
Phosphoribosyl-AMP cyclohydrolase
PhosphoribosylformiminoAICAR-phosphate
Phosphoribosyl-5-amino-1- phosphoribosyl-imidazole carboxamide
isomerase
Phosphoribosylformimino-AICAR-P
AICAR
Imidazoleglycerol phosphate synthase
D-erythro-inidazole-glycerol-phosphate
3AT
Imidazoleglycerol-phosphate dehydratase (IGPD)
Imidazole acetol-phosphate
Histidinol-phosphate aminotransferase
L-histidinol-phosphate
Histidinol phosphatase
L-histidinol
Histidinol dehydrogenase
L-histidinal
Histidinol dehydrogenase
Histidine
Trophocidal inhibition assays
o alamarBlue assay (McBride et al., 2004)
o Quantitative analysis via the reduction reactions of
metabolically active cells
o Resazurin, a non-fluorescent
indicator dye, is reduced to
bright red–fluorescent Resorufin
o Measurement taken over a time period of 72hrs (48hrs
then 24hrs with the presence of alamarBlue) for all
strains Campbell et al. (in prep)
100
Clinical T4 isolate – Optical Seeding Density
90
% alamarBlue reduction
80
70
60
50
40
30
20
10
>100%
0
5000
10000
20000
30000
40000
Acanthamoeba per well
50000
100000
200000
100
Clinical T4 isolate – Optical Seeding Density
90
% alamarBlue reduction
80
70
60
50
40
30
20
10
>100%
0
5000
10000
20000
30000
40000
Acanthamoeba per well
50000
100000
200000
Histidine deficient media - Optical Seeding Densities
Strain
Cell Density
Neff
8x105/ml – 40,000/well
Clinical T4
1x106/ml – 50,000/well
50371
8x105/ml – 40,000/well
50370
3x106/ml – 150,000/well
Lysine deficient media - Optical Seeding Densities
Strain
Cell Density
Neff
4x105/ml – 20,000/well
Clinical T4
1x106/ml – 50,000/well
50371
6x105/ml – 30,000/well
50370
2x106/ml – 100,000/well
Neff 3AT Inhibition
120
100
*
% alamarBlue reduction
80
60
IC50 - 62.5µM & 125µM
IC90 - 4000µM
40
20
0
-20
3AT (µM)
Neff 3AT Inhibition
120
100
*
% alamarBlue reduction
80
60
40
20
0
-20
3AT (µM)
120
Clinical T4 3AT Inhibition
100
*
% alamarBlue reduction
80
60
40
IC50 - 125µM & 250 µM
IC90 - 4000µM
20
0
3AT (µM)
50371 3AT Inhibition
120
100
% alamarBlue reduction
80
*
60
40
IC50 - 31.25µM & 62.5 µM
IC90 - 2000 µM & 4000µM
20
0
3AT (µM)
50370 3AT Inhibition
120
100
% alamarBlue reduction
80
60
40
*
IC50 - 62.5µM & 125 µM
IC90 - 4000µM
20
0
3AT (µM)
Histidine Rescue - Neff
120
100
% alamarBlue reduction
80
60
40
*
20
>100%
0
Cells+media
Cells+IC90
0.1
1
10
100
Concentration of exogenous histidine (µM)
1,000
10,000
Histidine Rescue - Neff
120
100
% alamarBlue reduction
80
60
40
*
20
>100%
0
Cells+media
Cells+IC90
0.1
1
10
100
Concentration of exogenous histidine (µM)
1,000
10,000
120
100
80
60
40
*
20
0
Cells+media
Cells+IC90
0.1
1
10
100
1,000
10,000
Histidine Rescue - 50371
120
100
% alamarBlue reduction
80
60
40
*
20
>100%
0
Cells+media
Cells+IC90
0.1
1
10
100
1,000
10,000
140
Histidine Rescue - 50370
% alamarBlue reduction
120
100
80
60
*
40
20
>100%
0
Cells+media
Cells+IC90
0.1
1
10
100
1,000
10,000
3AT Cytotoxicity on PC-3 cells
8.00E+06
7.00E+06
Total Flux [p/s]
6.00E+06
5.00E+06
4.00E+06
3.00E+06
2.00E+06
1.00E+06
0.00E+00
Control
Triton X 3%
125
250
500
3AT (µM)
1000
2000
4000
Conclusion 1
o It has been identified that the histidine biosynthesis pathway is
present within Acanthamoeba spp. presenting a potential
therapy targeting IGPD
o 3AT inhibits the various strains of Acanthamoeba in a dose
dependent manner but has minimal cytotoxicity effect on
human prostate cancer cells (luciferase +)
o The gene sequence of IGPD has been amplified from all strains
of Acanthamoeba showing definitive evidence of the presence
of the histidine biosynthesis pathway
o Drugs designed against the histidine biosynthesis pathway may
improve preventative measures in contact lens solutions or the
treatment of keratitis
Contents
o Characterisation of the histidine biosynthesis pathway in
Acanthamoeba spp.
o Inhibition by targeting Imidazoleglycerol-phosphate
dehydratase (IGPD)
o Identification of the lysine biosynthesis pathway in
Acanthamoeba spp.
o Inhibition by targeting Homoisocitrate dehydrogenase
(HIcD)
o Lysine biosynthesis can be synthesised by two distinct
pathways
o Diaminopimelate pathway (DAP) found in plants,
bacteria, algae and lower fungi
o α-aminoadipate pathway (AAA) found in some algae,
archaea and higher fungi
o Extensive bio-informatical searches shows that the AAA
pathway may be present within Acanthamoeba
o A known inhibitor (Thiahomoisocitrate) of the AAA
pathway inhibits Homoisocitrate dehydrogenase
o Thiahomoisocitrate is not commercially available
o Synthesis of Thiahomoisocitrate
The Lysine biosynthetic
pathway
α-Ketoglutarate + acetyl-CoA
α-aminoadipate
pathway
Homocitric acid
Homocitrate synthase
Dehydration
Cis-Homoaconitic acid
Homoaconitase
Homoisocitric acid
Thiahomoisocitrate
Homoisocitrate dehydrogenase
Oxaglutarate
Quick loss of Carbon dioxide
α-Ketoadipic acid
Aminoadipate aminotransferase
L-α-Aminoadipic acid
ATP & NADPH +
Aminoadipate reductase
L-α-Aminoadipic acid-δ-Semialdehyde
L-glutamate +
Saccharopine reductase
L- Saccharopine
Saccharopine dehydrogenase
L-Lysine + α-Ketoglutarate
The Lysine biosynthetic
pathway
α-Ketoglutarate + acetyl-CoA
α-aminoadipate
pathway
Homocitric acid
Homocitrate synthase
Dehydration
Cis-Homoaconitic acid
Homoaconitase
Homoisocitric acid
Thiahomoisocitrate
Homoisocitrate dehydrogenase
Oxaglutarate
Quick loss of Carbon dioxide
α-Ketoadipic acid
Aminoadipate aminotransferase
L-α-Aminoadipic acid
ATP & NADPH
+ Aminoadipate reductase
L-α-Aminoadipic acid-δ-Semialdehyde
L-glutamate
+ Saccharopine reductase
L- Saccharopine
Saccharopine dehydrogenase
L-Lysine + α-Ketoglutarate
Molecular biology
o Using Lysine deficient media wean the cells from rich media into
deficient media only from 50% to 80% then 100%
o Force Acanthamoeba to produce these amino acids through
their biosynthesis pathways (if possessed)
o Once growing in 100% deficient media 2x106 cells are used for
RNA extraction
o cDNA is then synthesised from the RNA
o Using molecular techniques, PCR amplification of the gene
through these biosynthesis pathways using specific primers
designed from other species aligned to Acanthamoeba contig
from baylor college of medicine
Primer name
Sequence
HIcD For7
5’ CCAACTCTCCTCGATCGCCATC 3’
Sequence
size
22
HIcD Rev7
5’ GAAGGGGGGGATAAACAC 3’
18
Histidine deficient media - Optical Seeding Densities
Strain
Cell Density
Neff
8x105/ml – 40,000/well
Clinical T4
1x106/ml – 50,000/well
50371
8x105/ml – 40,000/well
50370
3x106/ml – 150,000/well
Lysine deficient media - Optical Seeding Densities
Strain
Cell Density
Neff
4x105/ml – 20,000/well
Clinical T4
1x106/ml – 50,000/well
50371
6x105/ml – 30,000/well
50370
2x106/ml – 100,000/well
Neff Thiahomoisocitrate Inhibition
125
105
% alamarBlue reduction
*
85
65
IC50 - 5000µM
45
25
5
-15
Thiahomoisocitrate (µM)
50370 Thiahomoisocitrate Inhibition
130
110
*
% alamarBlue reduction
90
70
50
30
10
-10
Thiahomoisocitrate (µM)
120
Lysine Rescue - Neff
% alamarBlue reduction
100
80
*
60
40
20
0
Cells+media
Cells+IC50
0.1
1
10
100
Concentration of exogenous Lysine (µM)
1,000
10,000
Lysine Recue – 50370
120
% alamarBlue reduction
100
80
*
60
40
20
0
Cells+media
Cells+IC50
0.1
1
10
100
Concentration of exogenous Lysine (µM)
1,000
10,000
Thiahomoisocitrate Cytotoxicity on PC-3 cells
9.00E+06
8.00E+06
7.00E+06
Total Flux [p/s]
6.00E+06
5.00E+06
4.00E+06
3.00E+06
2.00E+06
1.00E+06
0.00E+00
Control
Triton X 3%
156.25
312.5
625
Thiahomoisocitrate (µM)
1250
2500
5000
Thiahomoisocitrate Cytotoxicity on PC-3 cells
9.00E+06
8.00E+06
7.00E+06
Total Flux [p/s]
6.00E+06
5.00E+06
4.00E+06
3.00E+06
2.00E+06
1.00E+06
0.00E+00
Control
Triton X 3%
156.25
312.5
625
Thiahomoisocitrate (µM)
1250
2500
5000
Conclusion 2
o Acanthamoeba spp. have been found to grow in deficient media
which lacks the amino acid lysine, signifying that the lysine
biosynthesis pathway is present
o It has been identified that the AAA pathway for lysine biosynthesis is
present within Acanthamoeba presenting a potential drug target
against HIcD using Thiahomoisocitrate
o The gene sequence of HIcD has been amplified from Neff and ISO
Polyphaga strains of Acanthamoeba showing definitive evidence of
the presence of the lysine biosynthesis pathway
o 3-D crystal structure would lead to the design of specific inhibitors of
AcHIcD which may improve preventative measures in contact lens
solutions or the treatment of keratitis
Summary
o All isolates of Acanthamoeba possesses the histidine and
lysine biosynthesis pathways
o This presents potential drug targets against clinical
isolates of Acanthamoeba
o The addition of amino acid inhibitors does cause
inhibition of Acanthamoeba, these may be added to
contact lens solutions as a preventative of infection or
potentially treating keratitis
o 3-D X-ray crystallography would provide further
information about molecular arrangement and specific
design against Acanthamoeba enzymes
Acknowledgements
o Sara Campbell
o Craig Roberts
o Callum McHugh and Monika Gocal
o Fiona Henriquez
o UWS for the studentship

similar documents