Sequence Alignment and comparison

Report
SEQUENCE ALIGNMENT AND
COMPARISON BETWEEN BLAST AND
BWA-MEM
S C H O O L O F C O M P U T I N G
AN D R E W M AX W E L L
9 / 1 1 / 2 0 1 3
OUTLINE
• BLAST
• BWA-MEM
• Comparisons
BLAST
• Basic Local Alignment Search Tool
• Developed by NCBI
•
•
•
•
NCBI - National Center for Biotechnology Information
NLM – US National Library of Medicine
NIH – National Institute of Health
http://blast.ncbi.nlm.nih.gov/
• Latest Version (executable)
• 2.2.28+
• ftp://ftp.ncbi.nlm.nih.gov/blast+/LATEST/
BLAST
• A suite of tools that work together to search for
similar sequences of different protein or nucleotide
DNA sequences.
• Three Categories of Applications
1. Search Tools
2. BLAST Database Tools
3. Sequence Filtering Tools
• BLAST Command Line User Manual
• http://www.ncbi.nlm.nih.gov/books/NBK1763/
SEARCH APPLICATIONS
• Execute a BLAST search.
• blastn – Nucleotide Blast
• Nucleotide database using nucleotide query.
• blastp - Protein Blast
• Protein database using protein query.
• blastx
• Protein database using translated nucleotide query.
• tblastx
• Translated nucleotide database using a translated nucleotide
query.
• tblastn
• Translated nucleotide database using a protein query.
SEARCH APPLICATIONS CONT.
• psiblast
• Position-Specific Iterated BLAST
• Finds sequences significantly similar to the query in a
database search and uses the resulting alignments to build
a Position-Specific Score Matrix (PSSM).
• rpsblast
• Reverse Position-Specific BLAST
• Uses a query to search a database of pre-calculated PSSMs
and report significant hits in a single pass.
• rpstblastn
• Searches database using a translated nucleotide query.
BLAST DATABASE APPLICATIONS
• Create or examine BLAST databases.
• makeblastdb
• Creates BLAST databases.
• blastdb_aliastool
• Manage BLAST databases.
• Search multiple databases together or search a subset of
sequences within a database.
• makeprofiledb
• Builds an RPS-BLAST database.
• blastdbcmd
• Examine the contents of a BLAST database.
SEQUENCE FILTERING APPLICATIONS
• Segmasker
• Identifies and masks low complexity regions* of protein
sequences.
• Dustmasker
• Similar to segmasker but for nucleotide sequences.
• Windowmasker
• Uses a genome to identify sequences represented too often to
be of interest to most users.
• *Low-Complexity Regions – Regions of a sequence
composed of few elements.
• These will be ignored by BLAST unless explicitly told to include
them in searches.
• May achieve high scores that may bump more significant
sequences.
BLAST ALGORITHM
http://www.ncbi.nlm.nih.gov/books/NBK62051/bin/blastpic1.jpg
E-VALUE
• The number of hits to see by chance when
searching the database.
• This value decreases exponentially when the score
is increased.
• The lower the e-value is, the more significant the
match is.
• This also depends on the length of the query
sequence. E-values will be higher with shorter
sequences because there is a higher probability of
a query sequence occurring in the database by
chance.
BITSCORE
• The bitscore value is derived from the raw
alignment score S.
http://www.ncbi.nlm.nih.gov/books/NBK21106/bin/glossfig1.jpg
• Lambda and K are statistical parameters of the
scoring system.
EXAMPLE RUN
FASTA FORMAT
• Text-based format representing nucleotide or
peptide sequences.
• A “>”, followed by the sequence identifier, then an
optional description.
• >seq_1 Some description
• GAGGGCTCATCCGGGAATCGAACCCGGGACCT
CTCGCACCCTAAGCGAGAATCATACGACTAGACC
AATGAGCCGTGTTCAAAGAGTGTCAAAATGTGTTTC
GAGCGTCTATGTCCAAAGTGAATTGCTTGTCTTTTGA
GTTTTGCGATTG
SAMPLE OUTPUT
BWA-MEM
• Burrows-Wheeler Aligner
• A software package for aligning sequences against
large reference genomes.
• The BWA package contains three different
algorithms: BWA-backtrack, BWA-SW, and BWAMEM.
• Manual Page
• http://bio-bwa.sourceforge.net/bwa.shtml
BWA-MEM
• Can align 70bp to 1Mbp
• MEM – Maximal Exact Matches
• Local alignment
HOW TO RUN
• Index the reference FASTA file.
• Run BWA-MEM with a query file (in FASTQ format)
against the reference database.
• The output is in a SAM file format.
FASTQ FORMAT
• Similar to a FASTA format, but with a quality score
added.
• @HWI-EAS397:8:1:1067:18713#CTTGTA/1
• TGGAGATGAGATTGTCGGCTTTATTACCCAGGGGC
GGGGGGTTATTGTA
• +
• Y^]Lcda]YcffccffadafdWKd_V\``^\aa^BBBBBBBBBB
BBBBB
• The quality score is an integer mapping of the
probability that the base is incorrect.
SAM FILE
• Eleven mandatory fields and a variable amount of
optional fields.
• The optional fields are a key-value pair of
TAG:TYPE:VALUE. These store extra information.
SAM REQUIRED FIELDS
SAM OPTIONAL FIELDS
BWA-MEM ALGORITHM
• Seeds alignments with maximal exact matches
• Then, uses affine-gap Smith-Waterman algorithm.
http://en.wikipedia.org/wiki/Smith%E2%80%93Waterman_algorithm
BWA-MEM OPTIONS
• t – Number of threads
• T – Don’t output alignment with score lower than
INT.
• a – Output all found alignments for single-end or
unpaired paired-end reads.
• (In output, ‘*’ are considered zero.)
EXAMPLE RUN
SAMPLE OUTPUT
REFERENCES
• NCBI Help Manual http://www.ncbi.nlm.nih.gov/books/NBK3831/
• Bwa - http://bio-bwa.sourceforge.net/
• FASTA - http://en.wikipedia.org/wiki/FASTA_format
• FASTQ - http://en.wikipedia.org/wiki/FASTQ_format
• Li, H, et al. (2009). The Sequence Alignment/Map
format and SAMtools. Vol. 25 no 16, Bioinformatics
Applications Note.

similar documents