From Bugs to Barcodes: Using Molecular Tools to Study

Report
From Bugs to Barcodes: Using
Molecular Tools to Study
Biodiversity
Mandy Butler, Heather Henter, Stephanie Mel
University of California, San Diego
Biodiversity
Biodiversity knowledge gap
How can we conserve what we don’t
know we have?
How can we address the biodiversity
knowledge gap?
BARCODING
DNA BARCODE
specific region in an organism's
DNA as a genetic marker to
identify species
How?
compare DNA sequence with
sequences in a public reference
library (GenBank or BOLD)
Why is barcoding useful?
Morphological identification
difficult for non-specialist
Anyone that can do PCR and
pay for sequencing can
generate barcode data
Student collaboration
ecology courses
Also, independent study students
molecular biology
courses
Invertebrate Animals
Scale=5 mm
Scripps Coastal Reserve
Hypothesis testing vs. Discovery science
Questions we have addressed:
What is the frequency of Africanized honey bees in our area?
(63%)
Is there zonation in species distribution of bloodworms in our
intertidal? (no)
Do flower-inhabiting thrips (Thysanoptera) specialize on
different species of plant host?
____________________________________
What species inhabit the sandy beach?
What spiders species are at our reserve?
BARCODING WORKSHOP
Morning:
1. Collect organisms
Afternoon:
2. Extract DNA
3. PCR
4. prepare DNA to be sent out for sequencing
5. bioinformatics with previous sequences
Today’s insect collecting
Each group:
insect net
aspirator & aspirator vials
2 mL vials with 70% ethanol
blank labels
white paper plate
fine paint brush
sharp pencil
kill jar
History of Barcoding
http://www.dnabarcoding101.org/
Future DNA
search engine:
1 minute,
1 sequence,
1 name,
1 penny.
Radio Shack,
barcorder
iBOL: create
a searchable
directory for
life on earth.
And to build
it,
7 billion searchers.
Introduction
http://www.dnabarcoding101.org/dna_barcoding_ani.html
Barcoding protocol
Insect collection
DNA extraction
Amplification of COI gene by PCR
Direct sequencing of cleaned up PCR
product
Analysis of sequence
Stink bug, image from Seattle Times
DNA EXTRACTION
• Remove leg if large insect
• Grind up entire insect if very small
• Follow extraction protocol
DNA from your organism
An Internal ID System for All Animals
The Mitochondrial Genome
Small ribosomal
DRNA
Loop
DNA
Cytochrome b
ND1
ND6
Typical Animal Cell
mtDNA
COI
ND5
Hstrand
ND4
L-strand
ND4L
ND3
Mitochondrion
ND2
COIII
COII
ATPase subunit 8
ATPase subunit 6
Slide from David E. Schinde
DNA from your organism
Selectively Amplify CO1 DNA
(make millions of copies)
PCR - Polymerase Chain Reaction
5’
3’
CO1 DNA
3’
5’
30+ cycles of amplification
PCR product: Billions of copies of CO1 DNA
sequence from your organism of interest
Run PCR product on a gel
Cut band out of gel with razor blade
Follow clean-up protocol
Cleaned up CO1
PCR product
from organism
of interest
Barcoding protocol
Insect collection
DNA extraction
Amplification of COI gene by PCR
Direct sequencing of cleaned up PCR
product
Analysis of sequence
WHAT IS THE CO1 DNA SEQUENCE
FROM MY ORGANISM OF INTEREST?
Send samples out for sequencing…
Compare CO1 sequences from different organisms
Org 1 - CTGCTGACATCGATGCTGATCGGAGTATCATAA
Org 2 - CTGCTGACATCGATGCTGATCGGACTATCATAA
Org 3 - CTGCTGACATTGATGCTGATCGGACTATCATAA
Org 4 - CTGCTGACATTGATGCTGATCGGACTATCATAA
Org 5 - CTGCTGACATCGATGCTGATCGGACTATCATAA
Discover a new species!
Ask exciting scientific questions!
Brooklyn vs. Bronx Bedbugs
What lives in the subway?
Expose a local restaurant!
Publish!
Why is a mitochondrial gene used for
barcoding?
Review of Mitochondrial DNA
–
–
–
–
–
Circular DNA, 17000 bp
Hundreds of copies per cell
Inherited from mother only – so haploid
No recombination
Contains 37 genes – no introns
• 22 tRNAs
• 2 rRNAs
• 13 genes involved in cellular respiration
http://www.geneticorigins.org/mito/intro.html
The CO1 gene is the standard gene for
barcoding in animals
• The cytochrome C oxidase (CO1) gene has been designated
the standard gene for barcoding of animals
• It is a protein coding gene of about 1500 bp with no introns
• The COI region that is used for barcoding includes the first half
of the gene and is approximately 650 basepairs long
– PCR is used to amplify this region; the PCR product is then sent for
sequencing
1. Mitochondrial genes are haploid
• In doing barcoding, we want to make the sequencing part as
easy as possible – we want to be able to isolate DNA, amplify
it and sequence it without having to clone the DNA
• Thus it is important to use a haploid gene as our identifying
gene. (If you used a diploid gene, you would get product with
possible 2 different sequences.)
• So we can’t use nuclear genes – instead we use a
mitochondrial gene for animal barcoding
2. Mitochondrial genes are present in
high copy numbers in cells
3. Mitochondrial genes exhibit more differences in
sequence among species than nuclear genes, and less
difference within species
• Sequence differences among closely related animal species
average 5- to 10-fold higher in mitochondrial than nuclear
genes.
• Intraspecific variation in mitochondrial DNA is low in most
animal species.
• Thus small intraspecific and large interspecific differences
make distinguishing genetic boundaries between species
easier, enabling more precise identification.
Universal primers
• “Universal primers” are primers that are designed to areas in
genes that are highly conserved among different species.
• Thus universal primers are not species specific
• This means that the primers are probably not totally
complementary to the sequence in your insect sample but
they are similar enough to hybridize at a low annealing
temperature sample
– The sequence in the CO1 gene in between where the primers
hybridize is less well conserved and thus can be used to differentiate
members of different species.
PCR conditions
• Since we do the annealing step at 42 C, we do often get nonspecific products
• We run a gel to see if the PCR worked, and then clean up the
PCR sequence to send for sequencing. Because we may have
extra bands, we will gel purify the band of the expected size,
which is 658 basepairs
– Sequencing will be done using the forward primer
• We will then analyze the sequences and use Blast to try
determine the genus and species of your samples
Bioinformatics
• First we determine if the sequence for the insect is in
Genbank by doing a Blast
• We will consider any hit with an identity of 97% or better the
same species.
• If the match is less than 97%, it means the barcode sequence
for theinsect is not in Genbank
Intraspecies genetic diversity
• Once we have a set of sequences from the
same organisms (i.e., same genus and species)
we will also look at genetic diversity within
that organism (SNPs)

similar documents