Genetic diversity

Report
Fall 2014
HORT6033
Molecular
Plant Breeding
INSTRUCTOR: AINONG SHI
HORT6033 web site: http://comp.uark.edu/~ashi/MB
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 5 (09/08/2014)
I. Genetic Diversity
II.Example
III.Homework
IV.Questions
Genetic Diversity and Benefit
Genetic diversity refers to any variation in the nucleotides,
genes, chromosomes, or whole genomes of organisms. It
entails looking at the genetic characteristics in the genetic
makeup of a species. It is different from genetic variability,
which describes the tendency of genetic characteristics to vary.
Genetic diversity serves as a way for populations to adapt to
changing environments. With more variation, it is more likely
that some individuals in a population will possess variations of
alleles that are suited for the environment.
www.ask.com
Genetic Diversity in Breeding
• Select parents for crossing
• Breeding varieties to fit environments, stress,
and consumer demand
• Genetic structure study and trait association
analysis
Causes of Genetic Diversity
•
•
•
•
Gene recommendation
Gene mutation
Gene transfer
Selection
Classification: INTERNAL USE
ONLY
Genetic Diversity
Genetic variation between and within species, which is measured by
determining the proportion of polymorphic loci across the genome, or
by the number of heterozygous individuals in a population.
Fruit size: large vs small
Fruit color: red vs yellow
Tomato spotted wilt virus (TSWV):
Resistance vs susceptible plant
TSWV resistance:
Resistance vs susceptible gene
Sw-5 vs sw-5
Resistant plant
Susceptible plant
DNA sequence diversity
SNP variation
AY007366-sw5b
LA3667
NY07-464
LA2823
TAATTTTCTCCTCAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTCGGAACCTGTAACTTGACTGAAAATATCTTGTAATAACTCTCTCCGA
------------------------------A----------------------Y-R----------------G---------------------M--C-R
------------------------------G----------------------T-A----------------A------------------------T-------------------------------G----------------------T-A----------------A------------------------T--
400
400
400
400
Genetic Diversity in World-wide Spinach
Spinach germplasm
DNA extraction
Genotyping by Sequencing
Data Analysis
SNP Discovery
Genetic Diversity
• Plant materials: A total of 413 spinach
genotypes were used in this study,
including 323 USDA-GRIN germplasm
originally collected from 33 countries.
• DNA extraction: genomic DNA is extracted
from spinach leaves using the CTAB.
• Sequencing: using GBS by HiSeq 2000 in
BGI
• SNP discovery: GBS data analysis using
DNASTAR Lasergene Genomics Suite,
TASSEL; Around half million SNPs were
discovered from the 413 spinach genotypes
using GBS by de novo assembly.
Genetic Diversity in Spinach
A mes 23662 A f ghanis tan
PI212328 A f ghanis tan
PI604787 A f ghanis tan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 A f ghanis tan
PI445782 Sy ria
PI219949 A f ghanis tan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 SouthKorea
PI433210 China
PI433211 Franc e
Bordeav x USA
PI604790 A f ghanis tan
PI173126 Turkey
PI224959 Iran
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 A f ghanis tan
PI445784 Sy ria
PI358247 Serbia
PI491261 Greec e
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Iraq
PI205234 Turkey
PI604784 A f ghanis tan
PI664499 China
PI217425 SouthKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakis tan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 A f ghanis tan
PI212119 A f ghanis tan
PI209646 Turkey
PI220686 A f ghanis tan
PI179588 Belgium
PI181808 Sy ria
PI220546 A f ghanis tan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 A f ghanis tan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
A lrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 A f ghanis tan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif ornia
PI648962 USA .Mary land
NSL184378 USA .Oregon
NSL184398 Calif ornia
V anc ouv er USA
PI531456 Hungary
NSL186328 USA .Oregon
PI358259 Serbia
PI648950 USA .Mary land
PI648952 USA .Mary land
PI648953 USA .Mary land
PI648958 USA .Mary land
PI648959 USA .Mary land
PI648951 USA .Mary land
PI648956 USA .Mary land
PI648960 USA .Mary land
PI648957 USA .Mary land
PI478393 China
Sev enR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 Franc e
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA .New Y ork
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 Sov ietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Oly mpia USA
NSL81328 USA .Mary land
NSL6097 USA .Minnes ota
NSL6092 USA .New Y ork
NSL65915 USA .Oregon
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hec tor USA
PI531451 Hungary
PI499372 Sov ietUnion
PI285751 Wars z aw a
PI379547 Serbia
Lion USA
Grey hand USA
Cheetah USA
A v enger USA
Interc eptor USA
Cherokee USA
Croc odile USA
Spinner USA
Nordic IV USA
T-Bird USA
PolarBear USA
Bolero USA
Bos s anov a USA
Laz io USA
Unipac k12 USA
Mig USA
Unipac k277 USA
Eagle USA
Whale USA
PI606707 NorthHolland
Ty ee USA
NSL6090 USA .Penns y lv ania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tarpy USA
PI648955 USA .Mary land
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Mis s ouri
PI274049 England
PI535897 Poland
PI261788 Franc e
NSL37031 Georgia
NSL6099 USA .Penns y lv ania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louis ana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Greec e
PI176775 Turkey
PI179590 Belgium
NSL26513 USA .Mic higan
NSL6693 USA .Mic higan
NSL6096 USA .Mis s ouri
NSL6088 USA .New Y ork
NSL6557 USA .Was hington
NSL22003 Calif ornia
NSL6087 USA .New Y ork
NSL22149 Calif ornia
NSL6082 USA .New Y ork
NSL92513 USA .Oregon
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Mary land
NSL6098 USA .V irginia
NSL28216 USA .Wy oming
NSL28217 USA .Wy oming
PI648961 USA .Mary land
NSL6094 USA .Penns y lv ania
Menoroa USA
Sardinia USA
Unipac k151 USA
04-103FA Y UA F
08-101 UA F
08-140 UA F
08-104 UA F
08-144 UA F
08F380 UA F
08-03-316f ay UA F
08-143 UA F
08-354REG UA F
08-135 UA F
08-150 UA F
08-167 UA F
04-103V GRS UA F
08-112 UA F
08-128 UA F
08-183 UA F
08-116 UA F
08-134 UA F
08-86-310 UA F
08-166 UA F
08-88-212 UA F
08-191 UA F
08-122 UA F
08-180 UA F
08-109 UA F
08-115 UA F
08-110 UA F
97154New UA F
Samis h USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
PI179591 Belgium
PI181923 Sy ria
PI222749 Iran
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egy pt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greec e
PI163309 India
PI648937 Sy ria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey
PI169679 Turkey
NSL6086 CaliforniaVancouver USA
• Genetic diversity:
380 SNPs were used for
genetic diversity analysis.
The genetic diversity
analysis indicated that there
was a geography (country)
factor during spinach
variety development and
spinach production.
0.05
Menoroa USA
PI171861 Turkey
08-1 5 UAF
Sardinia USA Ames236 2 Afghanistan
PI169685 Turkey
NSL6085 California
NSL18439PI8 Ca6 4lifo9r7niCha ina
PI169676 Turkey Samish USA
PI1696 8 Turkey NSL186328 USA.Oregon
PI175924 Turkey
08-183 UAF
NSL184380 California
PI165012 Turkey
NSL6090 USA.Pen sylvania
PI648956 USA.PI169M67a4ryTlaunrkdey
PI604784 Afghanistan
NSL184378 USA.Oregon PI174385 Turkey
PI169670 Turkey
08-1 2 UAF
PI217425 SouthKorea
PI163 09 India
08-128 UAF
PI169678 Turkey
08-03-316fay UAF 08-134 UAF
08-1 6 UAF
PI648936 Gre ce
08-104 UAF 08-143 UAF08-135 UAF
PI606707 NoPIrth6H4o8l9a6n4dCalifornia
PI184PI13670Se478rb0iaJapan
Hector USA PI604782 Afghanistan
PI64895 USA.Maryland
NSL6096 USA.Mis ouri
PI219 49 Afghanistan
PI4 5784 Syria
PI209647 Iran
PI206473 Turkey
Spin er USA
PI2 0686 Afghanistan
NSL608 USA.NewYork
NSL6 93 USA.Michigan
PI17186 Turkey
PI358250 Serbia
PI17904 Turkey
PI27404PIEn17g9l5PIa0n91d7T9u5rk9e7yBelgium
PI1767 8 Turkey PI205234 Turkey
PI179508 Iraq
EaNSLgle6USA09 USA.Pen sylvania
PI212328 Afghanistan
PI179041 Turkey
NordicIV USA
PI3 9548 Turkey
PI2 4959 Iran PI256079 Afghanistan
PI360710 France
PI274056 England
PI179594 Belgium PI174960 India
PI175312 India
PI174383 Turkey
PI43 21 France
PI6047 9 Japan
PI508504 SouthKorea
PI165710 Japan
PI5314 8 Hungary
PI49 373 SovietUnion
PI648942 China
PI648945 China
PI358251 Serbia
PI648947 China
PI360895 Netherland
PI648948 China
PI175926 Turkey PI648940 China
PI274052 England
PI175931 Turkey
PI175 95 Turkey
PI1767 1 Turkey
PI274050 EngPIlan5d31454 Hungary
PI204736 Turkey
PI3795 1 Serbia
PI207518 Afghanistan
PI274065 England
PI531PI42974Hu04n9gEnarygland
NSL2 0 3 California
PI358259 Serbia
PI648951 USA.Maryland
Lazio USA
PI1659 4 India
PI604786 Nepal
PI179593 Belgium
NSL28216 USA.Wyoming
Lion USA NSL92513 USA.ONSLrego2n 149 California
PI192945 China
NSL6087 USA.NewYork
Unipack151 USA
PI1767 0 Turkey
PI181923 Syria
Bordeavx USA
PI173127 Turkey
PI169026 Turkey PI21 632 Afghanistan Avenger USA
PI176769 Turkey
PI478393 China
PI204632 Turkey
Alrite USA
Interceptor USA
PI171867 TPIur1k7e6y7 4 Turkey
PI604787 AfPIg2h0a5n2i3s1taTnurkey
PI368 25 Serbia
TarpyNSLUSA81328 USA.Maryland
Polka USAPI169675 Turkey
PI296393 Iran NSL6095 USA.Mis ouri
PI174386 Turkey
PI171865 Turkey
PI175932 Turkey
PI174384 Turkey
PI2 2750 Iran
PI419218 China
PI211632 Afghanistan
PI212119 Afghanistan
PI209646 Turkey
PI220686 Afghanistan
PI179588 Belgium
PI181808 Syria
PI220546 Afghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 Afghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
Alrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
The above cluster mainly consists of the spinach germplasm from
Afghanistan, Iran, China, and India, Iran, and Japan
A mes23662 A f ghanistan
PI212328 A f ghanistan
PI604787 A f ghanistan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 A f ghanistan
PI445782 Syria
PI219949 A f ghanistan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 SouthKorea
PI433210 China
PI433211 France
Bordeavx USA
PI604790 A f ghanistan
PI173126 Turkey
PI224959 Iran
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 A f ghanistan
PI445784 Syria
PI358247 Serbia
PI491261 Greece
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Iraq
PI205234 Turkey
PI604784 A f ghanistan
PI664499 China
PI217425 SouthKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakistan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 A f ghanistan
PI212119 A f ghanistan
PI209646 Turkey
PI220686 A f ghanistan
PI179588 Belgium
PI181808 Syria
PI220546 A f ghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 A f ghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
A lrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 A f ghanistan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif ornia
PI648962 USA .Maryland
NSL184378 USA .Oregon
NSL184398 Calif ornia
V ancouver USA
PI531456 Hungary
NSL186328 USA .Oregon
PI358259 Serbia
PI648950 USA .Maryland
PI648952 USA .Maryland
PI648953 USA .Maryland
PI648958 USA .Maryland
PI648959 USA .Maryland
PI648951 USA .Maryland
PI648956 USA .Maryland
PI648960 USA .Maryland
PI648957 USA .Maryland
PI478393 China
SevenR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 France
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA .New Y ork
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 SovietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Olympia USA
NSL81328 USA .Maryland
NSL6097 USA .Minnesota
NSL6092 USA .New Y ork
NSL65915 USA .Oregon
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hector USA
PI531451 Hungary
PI499372 SovietUnion
PI285751 Warszaw a
PI379547 Serbia
Lion USA
Greyhand USA
Cheetah USA
A venger USA
Interceptor USA
Cherokee USA
Crocodile USA
Spinner USA
NordicIV USA
T-Bird USA
PolarBear USA
Bolero USA
Bossanova USA
Lazio USA
Unipack12 USA
Mig USA
Unipack277 USA
Eagle USA
Whale USA
PI606707 NorthHolland
Tyee USA
NSL6090 USA .Pennsylvania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tarpy USA
PI648955 USA .Maryland
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Missouri
PI274049 England
PI535897 Poland
PI261788 France
NSL37031 Georgia
NSL6099 USA .Pennsylvania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louisana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Greece
PI176775 Turkey
PI179590 Belgium
NSL26513 USA .Michigan
NSL6693 USA .Michigan
NSL6096 USA .Missouri
NSL6088 USA .New Y ork
NSL6557 USA .Washington
NSL22003 Calif ornia
NSL6087 USA .New Y ork
NSL22149 Calif ornia
NSL6082 USA .New Y ork
NSL92513 USA .Oregon
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Maryland
NSL6098 USA .V irginia
NSL28216 USA .Wyoming
NSL28217 USA .Wyoming
PI648961 USA .Maryland
NSL6094 USA .Pennsylvania
Menoroa USA
Sardinia USA
Unipack151 USA
04-103FA Y UA F
08-101 UA F
08-140 UA F
08-104 UA F
08-144 UA F
08F380 UA F
08-03-316f ay UA F
08-143 UA F
08-354REG UA F
08-135 UA F
08-150 UA F
08-167 UA F
04-103V GRS UA F
08-112 UA F
08-128 UA F
08-183 UA F
08-116 UA F
08-134 UA F
08-86-310 UA F
08-166 UA F
08-88-212 UA F
08-191 UA F
08-122 UA F
08-180 UA F
08-109 UA F
08-115 UA F
08-110 UA F
97154New UA F
Samish USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
PI179591 Belgium
PI181923 Syria
PI222749 Iran
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egypt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greece
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey
PI374233 Egypt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greece
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey
The above cluster mainly consists of the spinach germplasm from
Turkey, indicating these turkey germplasm has the similarity genetic
background.
A mes23662 A f ghanistan
PI212328 A f ghanistan
PI604787 A f ghanistan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 A f ghanistan
PI445782 Syria
PI219949 A f ghanistan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 SouthKorea
PI433210 China
PI433211 France
Bordeavx USA
PI604790 A f ghanistan
PI173126 Turkey
PI224959 Iran
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 A f ghanistan
PI445784 Syria
PI358247 Serbia
PI491261 Greece
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Iraq
PI205234 Turkey
PI604784 A f ghanistan
PI664499 China
PI217425 SouthKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakistan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 A f ghanistan
PI212119 A f ghanistan
PI209646 Turkey
PI220686 A f ghanistan
PI179588 Belgium
PI181808 Syria
PI220546 A f ghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 A f ghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
A lrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 A f ghanistan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif ornia
PI648962 USA .Maryland
NSL184378 USA .Oregon
NSL184398 Calif ornia
V ancouver USA
PI531456 Hungary
NSL186328 USA .Oregon
PI358259 Serbia
PI648950 USA .Maryland
PI648952 USA .Maryland
PI648953 USA .Maryland
PI648958 USA .Maryland
PI648959 USA .Maryland
PI648951 USA .Maryland
PI648956 USA .Maryland
PI648960 USA .Maryland
PI648957 USA .Maryland
PI478393 China
SevenR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 France
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA .New Y ork
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 SovietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Olympia USA
NSL81328 USA .Maryland
NSL6097 USA .Minnesota
NSL6092 USA .New Y ork
NSL65915 USA .Oregon
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hector USA
PI531451 Hungary
PI499372 SovietUnion
PI285751 Warszaw a
PI379547 Serbia
Lion USA
Greyhand USA
Cheetah USA
A venger USA
Interceptor USA
Cherokee USA
Crocodile USA
Spinner USA
NordicIV USA
T-Bird USA
PolarBear USA
Bolero USA
Bossanova USA
Lazio USA
Unipack12 USA
Mig USA
Unipack277 USA
Eagle USA
Whale USA
PI606707 NorthHolland
Tyee USA
NSL6090 USA .Pennsylvania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tarpy USA
PI648955 USA .Maryland
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Missouri
PI274049 England
PI535897 Poland
PI261788 France
NSL37031 Georgia
NSL6099 USA .Pennsylvania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louisana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Greece
PI176775 Turkey
PI179590 Belgium
NSL26513 USA .Michigan
NSL6693 USA .Michigan
NSL6096 USA .Missouri
NSL6088 USA .New Y ork
NSL6557 USA .Washington
NSL22003 Calif ornia
NSL6087 USA .New Y ork
NSL22149 Calif ornia
NSL6082 USA .New Y ork
NSL92513 USA .Oregon
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Maryland
NSL6098 USA .V irginia
NSL28216 USA .Wyoming
NSL28217 USA .Wyoming
PI648961 USA .Maryland
NSL6094 USA .Pennsylvania
Menoroa USA
Sardinia USA
Unipack151 USA
04-103FA Y UA F
08-101 UA F
08-140 UA F
08-104 UA F
08-144 UA F
08F380 UA F
08-03-316f ay UA F
08-143 UA F
08-354REG UA F
08-135 UA F
08-150 UA F
08-167 UA F
04-103V GRS UA F
08-112 UA F
08-128 UA F
08-183 UA F
08-116 UA F
08-134 UA F
08-86-310 UA F
08-166 UA F
08-88-212 UA F
08-191 UA F
08-122 UA F
08-180 UA F
08-109 UA F
08-115 UA F
08-110 UA F
97154New UA F
Samish USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
PI179591 Belgium
PI181923 Syria
PI222749 Iran
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egypt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greece
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey
Spinach Lines Developed by UAF
All UAF spinach lines merged together, indicating
• The Good: UAF has special spinach germplasm; and
• The Bad: UAF spinach lines have narrow genetic background.
Challenge:
• Continuously
develop unique
UAF spinach
varieties
• Introgress other
spinach genetic
background into
UAF spinach
lines in order to
broad genetic
diversity
PI179590 Belgium
NSL26513 USA.Michigan
NSL6693 USA.Michigan
NSL6096 USA.Missouri
NSL6088 USA.NewYork
NSL6557 USA.Washington
NSL22003 California
NSL6087 USA.NewYork
NSL22149 California
NSL6082 USA.NewYork
NSL92513 USA.Oregon
IndianSummer USA
PI358257 Serbia
NSL6086 California
NSL4683 USA.Maryland
NSL6098 USA.Virginia
NSL28216 USA.Wyoming
NSL28217 USA.Wyoming
PI648961 USA.Maryland
NSL6094 USA.Pennsylvania
Menoroa USA
Sardinia USA
Unipack151 USA
04-103FAY UAF
08-101 UAF
08-140 UAF
08-104 UAF
08-144 UAF
08F380 UAF
08-03-316fay UAF
08-143 UAF
08-354REG UAF
08-135 UAF
08-150 UAF
08-167 UAF
04-103VGRS UAF
08-112 UAF
08-128 UAF
08-183 UAF
08-116 UAF
08-134 UAF
08-86-310 UAF
08-166 UAF
08-88-212 UAF
08-191 UAF
08-122 UAF
08-180 UAF
08-109 UAF
08-115 UAF
08-110 UAF
97154New UAF
Samish USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
A mes23662 A f ghanistan
PI212328 A f ghanistan
PI604787 A f ghanistan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 A f ghanistan
PI445782 Syria
PI219949 A f ghanistan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 SouthKorea
PI433210 China
PI433211 France
Bordeavx USA
PI604790 A f ghanistan
PI173126 Turkey
PI224959 Iran
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 A f ghanistan
PI445784 Syria
PI358247 Serbia
PI491261 Greece
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Iraq
PI205234 Turkey
PI604784 A f ghanistan
PI664499 China
PI217425 SouthKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakistan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 A f ghanistan
PI212119 A f ghanistan
PI209646 Turkey
PI220686 A f ghanistan
PI179588 Belgium
PI181808 Syria
PI220546 A f ghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 A f ghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
A lrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 A f ghanistan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif ornia
PI648962 USA .Maryland
NSL184378 USA .Oregon
NSL184398 Calif ornia
V ancouver USA
PI531456 Hungary
NSL186328 USA .Oregon
PI358259 Serbia
PI648950 USA .Maryland
PI648952 USA .Maryland
PI648953 USA .Maryland
PI648958 USA .Maryland
PI648959 USA .Maryland
PI648951 USA .Maryland
PI648956 USA .Maryland
PI648960 USA .Maryland
PI648957 USA .Maryland
PI478393 China
SevenR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 France
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA .New Y ork
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 SovietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Olympia USA
NSL81328 USA .Maryland
NSL6097 USA .Minnesota
NSL6092 USA .New Y ork
NSL65915 USA .Oregon
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hector USA
PI531451 Hungary
PI499372 SovietUnion
PI285751 Warszaw a
PI379547 Serbia
Lion USA
Greyhand USA
Cheetah USA
A venger USA
Interceptor USA
Cherokee USA
Crocodile USA
Spinner USA
NordicIV USA
T-Bird USA
PolarBear USA
Bolero USA
Bossanova USA
Lazio USA
Unipack12 USA
Mig USA
Unipack277 USA
Eagle USA
Whale USA
PI606707 NorthHolland
Tyee USA
NSL6090 USA .Pennsylvania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tarpy USA
PI648955 USA .Maryland
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Missouri
PI274049 England
PI535897 Poland
PI261788 France
NSL37031 Georgia
NSL6099 USA .Pennsylvania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louisana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Greece
PI176775 Turkey
PI179590 Belgium
NSL26513 USA .Michigan
NSL6693 USA .Michigan
NSL6096 USA .Missouri
NSL6088 USA .New Y ork
NSL6557 USA .Washington
NSL22003 Calif ornia
NSL6087 USA .New Y ork
NSL22149 Calif ornia
NSL6082 USA .New Y ork
NSL92513 USA .Oregon
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Maryland
NSL6098 USA .V irginia
NSL28216 USA .Wyoming
NSL28217 USA .Wyoming
PI648961 USA .Maryland
NSL6094 USA .Pennsylvania
Menoroa USA
Sardinia USA
Unipack151 USA
04-103FA Y UA F
08-101 UA F
08-140 UA F
08-104 UA F
08-144 UA F
08F380 UA F
08-03-316f ay UA F
08-143 UA F
08-354REG UA F
08-135 UA F
08-150 UA F
08-167 UA F
04-103V GRS UA F
08-112 UA F
08-128 UA F
08-183 UA F
08-116 UA F
08-134 UA F
08-86-310 UA F
08-166 UA F
08-88-212 UA F
08-191 UA F
08-122 UA F
08-180 UA F
08-109 UA F
08-115 UA F
08-110 UA F
97154New UA F
Samish USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
PI179591 Belgium
PI181923 Syria
PI222749 Iran
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egypt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greece
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey
A SNP Set for Spinach Cultivar Identification
So far, a SNP set consists of 15 SNPs postulated from genetic diversity analysis, which can distinguish
and determine all 413 tested spinach genotypes.
(left: 15 SNPs; right: example of spinach using the 15 SNPs)
SNP_ID
SNP short read
record_298338
CAGCAAAAATGAAACCAAGTTTAAGAAATACCCA[A/T]AGTTCTATATTT
GAAGAAGAGAAATTTCATAAGATACCTCTTGTATA
record_298339
CAGCCCCATTCTAGAAATATTCATCCTCTACATCTTTAAAGGATGCCT[A/
G]TTCACATCTCCATTCTTATAGTATCCACTTCTG
record_298326
CAGCTTTTAAATCAGCTGAATTTCAACATTCGTAATCTGTTTGT[G/T]TAT
TATGTTTAAAGTTGTTTCTACTGATTATTGATGT
record_349043
CAGCCTAAATCAAGTGGTRATGCATTTTCTCCCCT[C/T]TTCTGATTCACT
TGAGGAATCTGTTTAGACATAGCTAATTTCATAA
record_349021
CAGCAATTCATTGTTATTTAAGGTATCGTTAAGTGTATTCAACGATTTTT
MTAACAAAATAACAAC[A/G]TTAAGGTTCGAGGAT
record_349037
CAGCCTTATTAGGCAAACAAGTC[C/T]CTAGAACAAGATCAATTTGATGT
TMAATTCCACGAATAGGAGGCGAACCTGGTGGTAA
record_349001
CAGCTAAAAGATTGGAGTAATAGTCGAATCCTCGAACCTTAA[C/T]GTTG
TTATTTTGTTAGAAAAATCKTTGAATACACTTAAC
record_298342
CAGCTCAAATATTAAACCCTTGCTGTTGGGATCTACTGTACTGAAGTAGT
AACTCTTCTAAGTAAAAGAATAAGCG[A/G]CTCTA
record_298310
CAGCTGTGAA[A/G]CTGAAATTAGTGTCATTTGATGTTATTGTGTTATTG
TGTTAATTTTCAAGTGTTGCCATTAATCAGTTTAC
record_298366
CAGCTCAGCAAAATCTAGCAAAGTGAATGATTTGGATCAGACTTATGATT
TTGTAA[A/T]GGGGGACCTTTTTCCCATACATTCC
record_349055
CAGCTGGACCTRGGAAGGGGAACATGCATGTTATCTTTCTAGATGT[C/G
]TTAAAAGTTAAAACAGGTGTGTTAAGCTTACTAAT
record_298345
CAGCAATGGACATGAAGCAGGTCGAAAGACCCACTTTACTTT[A/C]GCT
ACAACACGAATATTACCACAATCGAAATTGCGRTTT
record_298358
CAGCATCAGAATCTGTTTATTTCAGTCTAGATAATGTATATCAGCTTATTG
CTAGGAACT[C/T]TGATCCCTCAAAGTTCACAAT
record_349050
CAGCAGTCACAGCAACCTTTATGTCCCTGGGATGGAACTGACCGCGATT
ATCTGTAT[A/G]AAGAGGTRAGCTGTTTTGATCATC
record_298400
CAGCCACTAGGGCAAGAGCAGAAACT[A/C]CTTGTCCAATACATACATTT
TTAATATATAACCATGGTTATTTCATCTTTAGGGG
Hellcat
Unipack 277
Hector
Lion
Crocodile
Spinner
Cheetah
Polar Bear
T-Bird
Indian Summer
Megaton
Alrite
Tyee
Melody
Samish
Unipack 151
Lazio
Tarpy
Whale
Unipack 12
Eagle
Bolero
Denali
Cherokee
Vancouver
Regal
Tools for Genetic Diversity Analysis
1. Clustal X2 and TreeView X
• Clustal X2: http://www.clustal.org/
• TreeView X: http://darwin.zoology.gla.ac.uk/~rpage/treeviewx/download.html
2. MEGA 6
• http://www.megasoftware.net/megacc.php
Examples for Sw-5 of Tomato
Stevens-Sw5b
LA3667 Sw5b.5a
Stevens-Sw5a
LA3433 sw5
LA2823 sw5
NY07-464 sw5
Distance
Stevens-Sw5b
LA3667_Sw5ab
LA3433_sw5
Stevens-Sw5b
0
LA3667_Sw5ab
0.000
0.000
LA3433_sw5
0.006
0.006
0.000
LA2823_sw5
0.005
0.005
0.002
0.000
NY07-464_sw5
0.005
0.005
0.002
0.000
0.000
Stevens-Sw5a
0.002
0.002
0.008
0.006
0.006
Sw-5 sample data to download
LA2823_sw5
NY07-464_sw5
Stevens-Sw5a
0.000
Examples for Spinach
• Fifteen SNP data for spinach variety
determination
Download the 15 SNP set data
• Genetic diversity in world wide
spinach germplasm
Download the 760 SNP data for ww spinach
Homework
1. Use Clustal X2 and TreeView X to do
genetic diversity for 15 SNP data of
spinach lines;
2. Use MEGA 6 to do genetic diversity for 15
SNP data of spinach lines;
3. Use MEGA 6 to do genetic diversity for
world wide spinach germplasm

similar documents