Mutations and Their Significance

Report
o Record Definitions in your notebook:
• Somatic Cells  Any cell in a multicellular organism
except a sperm or egg cell (gametic cells)
• Gametic cells  A haploid cell such as an egg or
sperm
• Sex-linked trait are inherited genes that do
determine an individual’s sex
• Autosomal trait are inherited via genes that do not
determine an individual’s sex
• Exon  a coding region of a eukaryotic gene
• Intron  a noncoding, intervening sequence within
a eukaryotic gene
DO NOW: Record
definitions/diagrams in notebooks
• Phenotype: the physical and
physiological traits of an organism
• Karyotype: a method of organizing the
chromosomes of a cell in relation to
number, size, and type
Mutations and
Their
Significance
Sickle Cell Anemia
• Normal hemoglobin gene
…ACTCCTGAGGAG…
• Mutated hemoglobin gene …ACTCCTGTGGAG…
substitution
• Mutation type _____________________
• Result: Harmful, DNA base is changed, this change
substitutes the amino acid valine for glutamic acid.
Sickle cell disease is harmful, sometimes fatal.
Huntington’s Disease
• Normal HAP-1 gene …TACCCGTTACAGGCA…
• Mutated HAP-1 gene
…TACCCGTTACAGCAGCAGCAGCAGCAGGCA…
duplication/repeat
• Mutation type _____________________
• Result: Harmful, genetic defect on chromosome 4. The
defect causes a part of DNA, called a CAG repeat, to
occur many more times than it is supposed to.
Resistance to HIV
• Normal CKR-5 gene (susceptible to HIV infection)
• …CATTTTCCATACAGTCAGTATCAATTCTGGAAGAAT
TTCCAGACATTAAAG…
• Mutated CKR-5 gene (highly resistant to HIV)
• …CATTTTCCATACATTAAAG…
deletion
• Mutation type _____________________
• Result: Beneficial, protects individuals against strains
of HIV
Cystic Fibrosis
• Normal CFTR gene …AGCTAACAGGGG…
• Mutated CFTR gene …AGCTAGGGG…
deletion
• Mutation type _____________________
• Result: Harmful, thick mucus that clogs their lungs
and breathing passageways
RNA and Protein Synthesis
The Structure of RNA
• List the three main differences
between RNA and DNA.
o 1. DNA is double stranded, RNA is single
stranded
o 2. mRNA is a compliment to the DNA, but
it uses uracil (U) instead of thymine (T)
o 3. The sugar is RNA is ribose instead of
deoxyribose
The Structure of RNA
• Is the following sentence
true or false? RNA carries
the genetic message from
DNA in the nucleus to the
ribosomes in the cytoplasm.
True
Types of RNA
• Type
Function
• _____________
Carries copies of the
instructions for assembling amino acids from
DNA to the rest of the cell
• _____________
Together with proteins
forms the structures of ribosomes
• _____________
Organelle that functions as
the site of protein synthesis in the cytoplasm
• _____________
Transfers each amino acid
to the ribosome to help assemble proteins
Transcription
• Which of the following sentences are true about
transcription?
• 1. RNA Polymerase binds to DNA and separates the
DNA strands
• 2. RNA polymerase uses one strand of DNA as a
template to assemble nucleotides into a strand of
RNA
• 3. Sequences of DNA that are not involved in
coding for proteins are introns
• 4. The DNA sequences that code for proteins are
called exons
Transcription
• The purpose of transcription is to make a copy of
the genetic code contained in the DNA sequence
into mRNA which can leave the nucleus
• Enzymes copy one strand of DNA into a singlestranded mRNA molecule ( A binds with U, T binds
with A, G binds with C)
RNA Splicing
• Many RNA molecules from eukaryotic genes have
sections, called __________, edited out of them
before they become functional. The remaining
pieces, called __________, are splice together.
The Genetic Code
•
•
•
•
Genes code for polypeptides
DNA triplets (codons) code for one amino acid
Amino acids link together to form polypeptides.
Polypeptide presence or absence determines an
organism’s traits
The Genetic Code
• Proteins are made by joining ___________ into long
chains called _______.
• RNA contains ____ different bases: _______, ________,
_________, ________.
• The genetic code is read three letters at a time.
Each three letter “word” in mRNA is known as a
codon.
• A _______ consists of three consecutive nucleotides
that specify a single amino acid
Translation
• mRNA is transcribed in the nucleus, then enters the
cytoplasm and attaches to a ribosome
• Translation begins at AUG, the start codon. Each
tRNA has an anticodon whose bases are
complimentary to a codon on the mRNA strand
• The ribosome positions the start codon to attract an
anticodon, which is the part of tRNA that binds the
codon
• The ribosome moves along mRNA, binding new
tRNA molecules and amino acids
• COMPONENTS THAT MAKE UP THE GENETIC
CODE ARE COMMON TO ALL ORGANISMS
• Including, but not limited to:
o Universality of code (with some
exceptions)
o Structure of DNA is similar for most
organisms
o DNA triplets code for the same amino
acids in most organisms
Changes in DNA
Change in Base Sequence Vs. Chomosome-level changes
Insertion
Duplication
Deletion
Deletion
Substitution
Inversion
Frameshift
Translocation
Point
Non-disjunction
Changes in Base Sequence
• Frameshift
oChanges all codons from
that point foward
Changes in Base Sequence
• Point Mutation
o No change in amino acid (silent)
o Change in a single amino acid
• Sickle cell anemia
• PKU (Phenylketonuria)
• Hemophilia
• Color blindness
• Huntington’s disease
• Tay-Sachs disease
• Cystic fibrosis
Changes in Base Sequence
• Chromosome-level changes
o Normal karyotype to abnormal karyotype.
o Results of non-disjunction
• Down syndrome
• Turner syndrome
• Klinefelter syndrome
• Cri-du-chat syndrome
• Some mutations are beneficial to the organism.
o CKR5 deficiency (resistance to HIV)
• Process of evolution occurs because of changes in
traits caused by
mutations

similar documents