03 Genregulatie en epigenetica

Report
11 Genen
A
Van gen tot kenmerk
Een codon (triplet) komt overeen
met een bepaald aminozuur of
duidt start en stop aan.
AUG GUA CGA AAA CAC CGU UAA
UAA =
stopcodon
Arginine
Histidine
Lysine
Arginine
Valine
Methionine AUG = startcodon
GEN
GENEN
EIWIT
(enzym)
EIWITTEN
(enzymen)
KENMERK
KENMERK
VERBAND GEN - ERFELIJK KENMERK
Vb.
Maar ook: één gen
meerdere eiwitten
B
Genregulatie
Elke cel bevat alle genen
Meeste zijn inactief
‘standby’
Andere komen tot ‘expressie’
B.1 Genregulatie door inductie (prokaryoot)
Een ‘inductor’ activeert de genexpressie
Geen inductor
structuurgenen niet actief
inductor aanwezig
repressor niet actief
transcriptie van de structuurgenen
B.2 Genregulatie door repressie (prokaryoot)
Een ‘repressor’ stopt de genexpressie
de ‘repressor’ is inactief
genexpressie
de ‘repressor’ is actief
geen genexpressie
B.3 Genregulatie bij eukaryote cellen
de transcriptie wordt gereguleerd door een
integratorgen dat zelf onder controle staat van
een sensor die gevoelig is voor oa. hormonen
B.4 De epigenetische code
Dubbele helix onder de duim??
Verborgen erfelijke code laat genen zwijgen
DNA-code is de blauwdruk van het leven maar..
De volgorde van de vier bouwstenen van de dubbele
helix is niet het enige wat iemands erfelijke
eigenschappen bepaalt. Zelfs wat de moeder eet
tijdens de zwangerschap kan invloed hebben!
Allerlei epigenetische
‘labels’ fungeren als een
soort volumeknop waarmee
de activiteit van de genen
kan gereguleerd worden

organisatie chromatine
euchromatine
Nucleosomen verder
uit elkaar
Genexpressie mogelijk
heterochromatine
DNA sterk gecondenseerd

chemische labels aan de histonen
Chemische aanhangsels op de histonen
kunnen de expressie van genen …


onderdrukken
bv. methyl (CH3)
bevorderen
bv. acetyl (COCH3)

metylmerkers op DNA
Metylgroepen hechten zich op een nucleotide C die
gevolgd wordt door een nucleotide C
H
H
H-C-H
H
H-C-H
ACTACGAGTAGGATTTTCGATTGTCCCA
Gen gedeactiveerd

transposons
‘jumping genes’
Klonen zichzelf en sturen kopieën over het
ganse genoom. (oa. afkomstig van virussen)
kunnen in genen terechtkomen en
mutaties veroorzaken of genexpressie
onderdrukken of stimuleren
DNA beschermt zich hiertegen door
methylering
 imprinting
Imprinting verandert genen in de geslachtscellen waardoor die genen inactief worden.
Bij maternale imprinting wordt het gen dat
van moeder is geërfd inactief gemaakt en
komt dat van vader juist tot uitdrukking.
Imprinting van het gen van vaders kant
(paternale imprinting) zorgt ervoor dat het
gen vaders kant inactief wordt en dat van
moeder tot uitdrukking komt.
hypotetisch vb. van imprinting
Links: maternale
imprinting voor het
gen van huidskleur;
het ‘blank-gen’ van
de moeder komt niet
tot expressie bij de
nakomelingen
Rechts: paternale
imprinting
lijger
Lijger
♀ : tijger
♂ : leeuw
Tot 500 kg!
♂ tijger x ♀ leeuw
teeuw
 RNA-interferentie (RNAi)
Genonderdrukking door dubbelstrengs RNA.
•De ‘sense’-sequentie van mRNA bindt zich
met de ‘antisense’-sequentie (=dsRNA).
•Dit dsRNA bindt zich dan aan een
eiwitcomplex Dicer (=‘snijmachine’) dat het
in kleinere stukken hakt
•Één RNA-streng bijft aan een ander
eiwitcomplex (RISC) hangen en vormt een val
voor nieuw mRNA geen translatie mogelijk.

similar documents