AMG04

Report
A UGU GENOMU STRUKTŪRA
1
2013. GADA 1. MARTS
2
M ĀCĪBU PLĀNS UN LEKCIJU
SARAKSTS
Datums
08.02.2013
15.02.2013
22.02.2013
01.03.2013
Lekcijas temats
Iepazīšanās, ievadlekcija
Augu ģenētikas vēsture. Augi kā ģenētikas modeļorganismi.
Augu genomu struktūra un pētīšanas metodes
Augu genomu struktūra un evolūcija. Genomu polimorfisms, poliploīdija
08.03.2013
Molekulāro marķieri un to genotipēšanas tehnoloģijas un to pielietojums genoma kartēšanā
15.03.2013
22.03.2013
29.03.2013
05.04.2013
12.04.2013
19.04.2013
Kartēšana augos izmantojot eksperimentālas un dabiskas populācijas
Lekcija nenotiek
Lieldienu brīvdienas
Molekulārie marķieri augu selekcijā
Seminārs. Augu genoma struktūra un molekulārie marķieri
Augu - augu patogēnu molekulārā ģenētika un bioloģija
26.04.2013
Augu abiotiskā stresa izturības un hormonālās regulācijas molekulārā ģenētika
03.05.2013
Transgēno augu iegūšanas vēsture, metodes un pielietojums fundamentālos pētījumos. Latvijas
un ES likumdošana ĢMO kultūraugu līdzāspastāvēšanas un ierobežotas izmantošanas jomās
Transgēno augu pielietojums biotehnoloģijā. Ģenētiski modificēti kultūraugi.
10.05.2013
17.05.2013
24.05.2013
Seminārs. Augu abiotiskais un biotiskais stress un ĢMO
Lekcija nenotiek
Eksāmens
2013. GADA 1. MARTS
3
S INTĒNIJA

Sākotnēji šis termins nozīmēja, ka gēni ir uz vienas hromosomas,
t.i., sintēniski (no grieķu valodas burtiski “uz viena pavediena”)

Termins tiek plaši lietots, lai uzsvērtu, ka gēnu kārtība hromosomā
dažādiem organismiem ir vienāda (sintēniska)

Mikrosintēnija – gēnu kārtības saglabāšanās nelielā genoma rajonā

Kolinearitāte – gēnu (marķieru) kārtības saglabāšanās
2013. GADA 1. MARTS
4
G ĒNU KĀRTĪBAS SAGLABĀŠANĀS
EVOLŪCIJAS GAITĀ ( SINTĒNIJA )
A B CD E
Jaunu sugu
veidošanās
Sākotnējā
hromosoma
Suga 1
Suga 2
A B CD E
A B CD E
Neatkarīga evolūcija
mutācijas, gēnu duplikācijas, insercijas un delēcijas
A X B CE
A B B’ C D E
2013. GADA 1. MARTS
5
S INTĒNIJAS PIELIETOJUMS
GENOMU KARTĒŠANĀ

Kukurūzas – rīsu gēnu
sintēnija

Rīsu hromosoma ir
sintēniska kukurūzas 3
un 8 hromosomai.
2013. GADA 1. MARTS
6
C ILVĒKA – ŠIMPANZES UN CILVĒKA
– PELES GENOMU SALĪDZINĀJUMS

Genomu salīdzinājumi ļauj atbildēt uz fundamentāli
atšķirīgiem jautājumiem

Cilvēks – pele. Iespējams identificēt gēnus un kontroles
elementus, kas saglabājušies nemainīgi evolūcijas gaitā. Var
pētīt proteīnu funkcionālos domēnus, kas saglabājušies
nemainīgi, vai arī gēnus, kas atšķir abus organismus

Cilvēks – šimpanze. Genomi, tai skaitā nekodējošā DNS, ļoti
līdzīgi, kas ļauj identificēt mutācijas, kas radušās tieši cilvēka
evolūcijas gaitā. Iespējams identificēt mutācijas gēnos un
kodējošās daļās, kas potenciāli atšķir cilvēku no šimpanzes
2013. GADA 1. MARTS
7

M IEŽU – RĪSU UN MIEŽU –
A RABIDOPSIS SALĪDZINĀJUMS
Miežu – rīsu salīdzinājums
Miežu un rīsu līnijas atdalījās pirms 40 – 50 miljoniem gadu.
Miežu un rīsu genomā nereti saglabājusies gēnu kārtība
hromosomā. Zinot rīsu genoma sekvenci, iespējams paredzēt
kādi gēni atradīsies atbilstošā miežu genoma rajonā

Miežu – Arabidopsis salīdzinājums
Viendīgļlapji un divdīgļlapji atdalījās pirms >100 miljoniem
gadu. Nav saglabājusies līdzība gēnu kārtībā hromosomā.
Iespējams salīdzināt gēnu un to kodēto proteīnu struktūru.
Līdzīgiem gēniem nereti vēl aizvien ir arī līdzīga funkcija
2013. GADA 1. MARTS
G ENOMA STRUKTŪRAS
8
VARIĀCIJA

Ģenētiskās analīzes pamatā ir atšķirības starp organismiem un to
genomiem

Galvenās atšķirības starp genomiem ir:
- punktveida mutācijas;
- insercijas un delēcijas;
- kopiju skaita atšķirības;
- poliploīdija.
2013. GADA 1. MARTS
9
G ENOMU
DINAMIKA

http://www.intl-pag.org/19/abstracts/W11_PAGXIX_076.html

http://www.intl-pag.org/19/abstracts/W94_PAGXIX_583.html
2013. GADA 1. MARTS
10

M UTĀCIJU
FREKVENCES
Cilvēka un peles salīdzinājums (75 miljoni gadu neatkarīgas
evolūcijas)
Cilvēkiem mutāciju (aizvietoto bāzu pāru) frekvence - 2.2 × 10–9
aizvietojumu uz vienu nukleotīdu gadā vai ~2.2 × 10–8 uz vienu
nukleotīdu vienā paaudzē
Pelēm mutāciju (aizvietoto bāzu pāru) frekvence - 4.5 × 10–9 uz
vienu nukleotīdu gadā vai ~10–9 uz vienu nukleotīdu vienā paaudzē
Kukurūzas Adh1 un Adh2 lokusos - 6.5 × 10–9 aizvietojumu uz vienu
nukleotīdu gadā
2013. GADA 1. MARTS
11
P UNKTVEIDA
MUTĀCIJAS

Visbiežāk sastopamā atšķirība starp genomiem

Punktveida mutācijas notiek visās šūnās jebkurā laikā. Mutācijas
somatiskos audos netiek nodotas pēcnācējiem. Mutācijas izraisa DNS
replikācijas un reparācijas kļūdas, dažādi ķīmiskie savienojumi, UV un
jonizējošais starojums

Mutācijas ir normāls process. Tām vajadzētu notikt ar +/- konstantu
ātrumu, atšķirības mutāciju frekvencē liecina par izlasi

Mutāciju frekvence kodola, mitohondriju un hloroplastu genomos ir
atšķirīgas (dzīvnieku mtDNS mutāciju frekvence augstāka nekā kodola
genomā, bet augu cpDNS frekvence ir zemāka nekā kodola genomā
2013. GADA 1. MARTS
P UNKTVEIDA MUTĀCIJU
12

IEDALĪJUMS
Pēc DNS bāzu tipa
Tranzīcijas – transversijas

Pēc efekta uz proteīna sekvenci
Klusējošās vai sinonīmās mutācijas (aminoskābju sekvence
nemainās, vai tiek aizvietotas ar funkcionāli līdzīgu aminoskābi)
Nesinonīmās mutācijas (atšķirīgas aminoskābes);
Nonsense mutācijas (translācijas terminatora kodons)
2013. GADA 1. MARTS
13
P UNKTVEIDA
MUTĀCIJAS
2013. GADA 1. MARTS
14
I NSERCIJAS –
DELĒCIJAS

Indeli – retāki kā punktveida mutācijas , it īpaši kodējošās daļās

Mikrosatelītu polimorfisms var tikt uzskatīts par indel veidu,
piemēram:
AGCTGGATTGTGTGTGTGTGTGTGTGTGGGGAACTAC
AGCTGGATTGTGTGTGTGTGTGT..GTGGGGAACTAC

Indelus var izraisīt DNS replikācijas kļūdas, mobilo ģenētisko
elementu insercijas, kā arī ķīmiskie mutagēni, UV un jonizējošā
radiācija
2013. GADA 1. MARTS
15
I NSERCIJAS –
DELĒCIJAS
2013. GADA 1. MARTS
16
K OPIJU
SKAITA VARIĀCIJA

Kopiju skaita variācija attiecas uz lieliem genomiskās DNS rajoniem
(tūkstoši līdz miljoni bāzu pāru), kuri var būt atkārtoti genomā

Kopiju skaita variācija izraisa gēnu kopiju skaita izmaiņas un attiecīgi
arī to kodēto proteīnu daudzuma izmaiņas šūnā

Visvairāk pētīta cilvēkos, bet pilnīgi noteikti ir novērojama arī augu
genomā (Sebat et al. (2005) Large-scale copy number
polymorphism in the human genome. Science, 305: 525)
2013. GADA 1. MARTS
17
2013. GADA 1. MARTS
P OLIPLOĪDIJA
18

Poliploīdija augiem ir bieži sastopama
x – monoploīds hromosomu skaits, n – haploīds hromosomu skaits gamētās

Autopoliploīdija (piemēram, kartupeļi (2n = 4x = 48))

Allopoliploīdija (piemēram, kvieši (2n = 6x = 42), tritikāle)

Genoma duplikācijas un segmentālas duplikācijas

Kukurūza un rīsi ir seni tetraploīdi

Paterson et al. (2004) Ancient polyploidization predating divergence
of the cereals, and its consequences for comparative genomics.
2013.
1.
PNAS, 101: 9903
GADA
MARTS
P OLIPLOĪDJA
19

Poliploīdija var atgadīties spontāni vai tikt inducēta

Poliploīdi bieži ir sterili

Homologās hromosomas un homeologās hromosomas

Bivalenti, univalenti, trivalenti

Triploīdi (rodas diploīdas un tetraploīdas sugas krustojumos , x un
2x gamētas)

Eiploīdi, aneiploīdi
2013. GADA 1. MARTS
20
T RITICEAE GENOMU EVOLŪCIJA
2013. GADA 1. MARTS
21
P H LOKUSS UN HEKSAPLOĪDO
KVIEŠU RAŠANĀS

Kvieši (Triticum aestivum) ir heksaploīdi, bet to hromosomas
mejozē sadalās kā diploīdam (tātad n = 21)

Šo skaldīšanos nodrošina Ph lokuss uz 5B hromosomas, kurš novērš
homeologo hromosomu pārošanos mejozē

Ph lokuss ir izveidojies poliploidizācijas procesā pirms 8000 – 10000
gadiem

Ph lokuss atrodams tikai uz 5B hromosomas, bet ne 5A un 5D. Tas
atrodams gan tetraploīdajos un heksaploīdajos kviešos, bet ne
diploīdajās kviešu sugās
2013. GADA 1. MARTS
22
Griffiths et al. (2006) Nature, 439: 749
2013. GADA 1. MARTS
23
R ĪSU GENOMA DUPLIKĀCIJAS
Paterson et al. (2004) PNAS, 101: 9903
2013. GADA 1. MARTS
24
Salse et al. (2009) Reconstruction of monocotelydoneous proto-chromosomes
2013.
reveals faster evolution in plants than in animals. PNAS, 106:14908)
GADA
1. MARTS
25
A RABIDOPSIS GENOMA
Arabidopsis Genome Initiative (2000) Nature, 408: 796
DUPLIKĀCIJAS
2013. GADA 1. MARTS
M OLEKULĀRIE MARĶIERI
26
2013. GADA 1. MARTS
M ARĶIERI
27
Almost all aspects of life are engineered at the
molecular level, and without understanding
molecules we can only have a very sketchy
understanding of life itself
Francis Crick

Tāpat kā ceļojumā orientēties palīdz ceļa
stabi, genomā orientēties palīdz marķieri
2013. GADA 1. MARTS
A UGU
28

Morfoloģiskie marķieri –
vārpas forma un plēkšņu krāsa

Bioķīmiskie marķieri –dažāda
izmēra proteīnu zonas SDSPAGE

Molekulārie marķieri –
atšķirības DNS molekulas
nukleotīdu secībā
MARĶIERI
2013. GADA 1. MARTS
29

M OLEKULĀRO MARĶIERU
IEDALĪJUMS
Pēc polimorfisma veida DNS molekulas sekvencē
Punktveida mutāciju marķieri, mikrosatelītu marķieri

Pēc genotipa noteikšanas metodes
Restrikcijas fragmentu garuma polimorfisms, CAPS
(cleaved amplified polymorphic sequence)

Pēc genoma sekvences veida
Gēnu (cDNS) marķieri, anonīmie marķieri, retrotranspozonu
marķieri un tmldz.
2013. GADA 1. MARTS
30
M OLEKULĀRIE
MARĶIERI

RFLP – restrikcijas fragmentu garuma polimorfisms

AFLP – amplificētu fragmentu garuma polimorfisms

SSR – mikrosatelītu garuma polimorfisms

SNP – punktveida mutācija
2013. GADA 1. MARTS
31
B AKTĒRIJU GENOMA
RESTRIKCIJAS ANALĪZE
http://wheat.pw.usda.gov/~lazo/docs/xmal/rflps.html
2013. GADA 1. MARTS
32
P OLIMORFISMA DETEKCIJA
NOTEIKTĀ GENOMA RAJONĀ

Augu genomi lieli un kompleksi un starp dažādiem vienas
sugas indivīdiem pastāv ļoti daudzas atšķirības
(polimorfismi) genoma līmenī

Kā noteikt atšķirības DNS sekvencē noteiktā genoma
rajonā?

DNS zondes un DNS hibridizācija

Polimerāzes ķēdes reakcija ar specifiskiem
oligonukleotīdiem
2013. GADA 1. MARTS
RFLP
33
SHĒMA
I
Iedomāts ~150 000 bp gDNS rajons
GT1
GT2
X
GT1 GAATTC
GT2 AAATTC
Diploīds miežu genoms = 10x109 bp
Restriktāze EcoRI (G^AATTC) vidēji
šķeļ ik pēc 46=4096 bp
Vidēji sagaidāmi 2.5x106 DNS
fragmenti
Botstein et al. (1980) Construction of a genetic linkage map in man using restriction fragment length
polymorphisms. American J Human Genetics, 32:314.
2013. GADA 1. MARTS
RFLP
34

SHĒMA
II
Genomiskās DNS restrikcija ar EcoRI, DNS fragmentu
elektroforētiska sadalīšana agarozes gelā
M GT1 GT2
M GT1 GT2
1. Southern blots
2. Hibridizācija ar
specifisku zondi
3. Autoradiogrāfija
2013. GADA 1. MARTS
35
G ENOMISKĀS DNS RESTRIKCIJA
RFLP ANALĪZEI
Kang and Yang (2004) BMC Biotechnology, 4:20
2013. GADA 1. MARTS
36

RFLP
REZULTĀTI
DNS tiek šķelta ar restrikcijas
fermentu, fragmenti tiek sadalīti
agarozes gēlā atbilstoši to
garumam un noteiktu fragmentu
garumu nosaka izmantojot
hibridizācijas zondes. Pirmās
paaudzes molekulāro marķieru
kartes
2013. GADA 1. MARTS
37
RFLP TRŪKUMI UN
PRIEKŠROCĪBAS

Nepieciešamas specifiskas zondes – pirmais solis RFLP
genoma kartēšanā ir hibridizācijas zondu izveidošana

Laikietilpīga metode, Southern hibridizācija nav
automatizējama

Relatīvi neliels alēļu skaits, problēmas ar krosshibridizāciju

Lielākoties kodominanti marķieri

Robusta metode, ja atstrādāti tehniskie aspekti, tā ir jutīga un
droša

Vēl aizvien “zelta standarts”, pat salīdzinot ar mūsdienīgākām
metodēm
2013. GADA 1. MARTS
38
RFLP
PIEMĒRI
2013. GADA 1. MARTS
39
RFLP
VARIANTI

Genoma kompleksitātes samazināšana ar PCR, nevis
specifiskām zondēm

Detekcijai izmanto fluorescentās krāsas, nevis
autoradiogrāfiju, fragmentus sadala uz sekvenatora,
nevis agarozes gelā
2013. GADA 1. MARTS
40
T-RFLP

Terminālo restrikcijas fragmentu garuma polimorfisms

http://rdp8.cme.msu.edu/html/t-rflp_jul02.html
2013. GADA 1. MARTS
41
M OLEKULĀRIE MARĶIERI –
AFLP

DNS polimorfismu detekcija balstoties uz restrikcijas
enzīmu šķelšanu

Uz PCR balstīta metode genoma kompleksitātes
samazināšanai

Fragmentus sadala denaturējošā poliakrilamīda gelā
(sekvenēšanas gelā), vai arī kapilārajā elektroforēzē

Vos et al. (1995) AFLP: a new technique for DNA
fingerprinting. Nucleic Acids Res, 23: 4407
2013. GADA 1. MARTS
42
2013. GADA 1. MARTS
43
S ELEKTĪVO NUKLEOTĪDU SKAITA
IETEKME UZ AFLP
A – viens selektīvs nukleotīds
B – divi selektīvi nukleotīdi
C – trīs selektīvi nukleotīdi
D – četri selektīvi nukleotīdi
I – III dažādas praimeru kombinācijas
2013. GADA 1. MARTS
44
AFLP KĀ UNIVERSĀLA
MARĶIERSISTĒMA
I – Arabidopsis
II – tomāts
III – kukurūza
IV – cilvēks
2013. GADA 1. MARTS
45
AFLP PRIEKŠROCĪBAS UN
TRŪKUMI

Dominanta marķiersistēma – DNS fragmenti tiek skaitīti kā
+/- (1 vai 0)

Universāla marķiersistēma – izmantojama jebkuram
organismam

Liels marķieru daudzums jau no dažām praimeru
kombinācijām (van Os et al. (2006) Construction of a 10,000marker ultradense genetic recombination map of potato:
providing a framework for accelerated gene isolation and a
genomewide physical map. Genetics, 173: 1075)

Iespējams automatizēt izmantojot fragmentu analīzi uz
sekvenatora

Patentēta tehnoloģija
2013. GADA 1. MARTS
46
M OLEKULĀRIE MARĶIERI –
SSR

Mikrosatelīti (arī Simple Sequence Repeats (SSR)) , piemēram, (AG)15

Rajons, kas satur mikrosatelītu atkārtojumu tiek amplificēts ar PCR un
fragmenti tiek sadalīti agarozes vai poliakrilamīda gēlos

Weber and May (1989) Abundant class of human DNA polymorphisms
which can be typed using the polymerase chain reaction. Am J Hum
Genet, 44: 388

Litt and Luty (1989) A hypervariable microsatellite revealed by in vitro
amplification of a dinucleotide repeat within the cardiac muscle actin
gene. Am J Hum Genet, 44: 397
2013. GADA 1. MARTS
47
SSR
2013. GADA 1. MARTS
SSR
48
ĪPAŠĪBAS

Kodominanti marķieri

Liels skaits alēļu katrā lokusā

Viens noteikts polimorfisma veids

Nepieciešams neliels genomiskās DNS daudzums,
tehniski vienkāršāki nekā RFLP

Iespējams analizēt lielu paraugu skaitu, it īpaši, ja
izmanto fluorescenti iezīmētus DNS fragmentu
analīzi ar kapilāro elektroforēzi
2013. GADA 1. MARTS
49
SSR FRAGMENTU KAPILĀRĀ
ELEKTROFORĒZE
Wang et al. (2003) Genome Introgression of Festuca mairei into Lolium perenne
Detected by SSR and RAPD Markers. Crop Sci, 43: 2154
2013. GADA 1. MARTS
50

M OLEKULĀRIE MARĶIERI –
SNP
SNP – single nucleotide polymorphism (punktveida
mutācija)
Restrikcijas ar AgeI
2013. GADA 1. MARTS
51
SNP
RAKSTUROJUMS

Galvenokārt bialēli marķieri, taču principā
iespējami četri varianti katrā saitā

SNP – visbiežāk sastopamais ģenētiskā
polimorfisma veids

SNP kombinācijas veido haplotipus (haploīdos
genotipus)

Brookes AJ (1999) The essence of SNPs. Gene,
234: 177
2013. GADA 1. MARTS
A LĒLES , HAPLOTIPI ,
52
MUTĀCIJAS
Lokuss
cons
G1
G2
G3
G4
G5
G6
M1
R
G
A
A
A
A
A
M2
Y
C
T
T
C
T
T
M3
S
C
C
C
C
C
G
Diploīds organisms,
homologo hromosomu pāris
katrā lokusā var saturēt 2 alēles
H1
H2
H2
H3
H2
H4
A1
A2
G
A
C
T
C
C
PCR amplifikācija
A1 un A2 fragmentu maisījums
PCR fragmentu sekvenēšana
R
Y
C
Haplotipu fāze nav zināma
Nevar atšķirt H1, H2 un H3 haplotipus
2013. GADA 1. MARTS
SNP GENOTIPĒŠANAS
53
TEHNOLOĢIJAS

Dažādas... Piemēram RFLP...

CAPS – Cleaved Amplified Polymorphic
Sequences

Alēles specifiska PCR amplifikācija, piemēram,
Applied Biosystems SNaPshot®

Pirosekvenēšana
2013. GADA 1. MARTS
54
A LĒLES SPECIFISKI
OLIGONUKLEOTĪDI
2013. GADA 1. MARTS
55
A PPLIED B IOSYSTEMS
SN A P SHOT
Pievieno četrus dažādus ddNTP
(A – dR6G, C – dTAMRA, G – dR110, T – dROX)
Reakcijas produktus sadala kapilārajā
elektroforēzē
2013. GADA 1. MARTS
56
A PPLIED
B IOSYSTEMS
SN AP S HOT
2013. GADA 1. MARTS
57
ABI SNP LEX
Dai et al. (2008) BMC Medical Genomics, 1: 24
2013. GADA 1. MARTS
58
P IROSEKVENĒŠANA
2.
3.
1.
4.

http://www.pyrosequencing.com/DynPage.aspx?
id=7454&mn1=1366&mn2=1367
2013. GADA 1. MARTS
59
P IROSEKVENĒŠANA SNP ANALĪZE
2013. GADA 1. MARTS
60
A UGSTAS CAURLAIDSPĒJAS
SNP GENOTIPĒŠANA

Vienlaicīga vairāku tūkstošu SNP analīze simtos DNS
paraugu

Jo vairāk SNP lielākā paraugu skaitā, jo lielāka
iespēja atrast noteiktu SNP asociāciju ar fenotipu

Augstas caurlaidspējas genotipēšanai nepieciešama
specializēta (dārga) aparatūra, taču tā bieži
pieejama arī kā pakalpojums

Affymetrix SNP čipi

Illumina SNP čipi
2013. GADA 1. MARTS

similar documents