MOLEKÜLER VERÝLERÝN FORMATLANMASI

Report
MOLEKÜLER VERİLERİN
FORMATLANMASI
(NEXUS,MEGA,FASTA)
 Biyoinformatik, biyolojik bilgilerin yaratılması ve
saklanması için veritabanlarının oluşturulmasıdır.
 Bu konudaki çalışmaların çoğu biyolojik verilerin
analizi ile ilgilidir.
 Artan sayıdaki projelerde biyolojik bilgilerin
organizasyonu gerekmektedir.
 Bu alanda oluşturulan veritabanlarının büyük bir
kısmını nükleik asitler oluşturmaktadır
 Milyonlarca nükleotidin depolanması ve
organizasyonu için veritabanlarının
oluşturulması, araştırıcıların bu bilgilere
ulaşabilmeleri ve yeni veriler girebilmeleri için ilk
aşamadır.
 Biyoinformatik'te nükleotid dizi bilgilerinin
organizasyonu ve depolanması görevini üstlenmiş
üç kuruluş vardır:
 Genbankası (GenBank),
 Avrupa Moleküler Biyoloji Laboratuvarı
(EMBL)
 DNA Japonya veritabanıdır (DDBJ)
Dizi bilgileri veritabanlarında iki
formda bulunur;
 Bunlardan birincisi; yazarlar/diziyi veritabanına
ilk işleyenler, kaynak gösterimleri, biyolojik
atıflar ve dizinin kendisiyle; intronlar, eksonlar,
başlangıç ve bitiş kodonları vb bilgiyi içeren bir
tablodan oluşan tam bilgi
 İkincisi ise; hızlı benzerlik araştırmaları için
kullanılan ve sadece diziyi içeren FASTA
formatıdır. Accession (ulaşma) numaraları, herbir
diziyi belirleyen özgün kimliklerdir ve dizi
veritabanına ilk kez girildiğinde verilir.
BİYOİNFORMATİKTE
KULLANILAN ÖNEMLİ TERİMLER
Accession number (GenBank): Bir dizi GenBank’a
kaydedildiği zaman bu kayıt için verilen yada kayda özel
kimlik numarasıdır. Bir büyük harf ve ardından gelen 5
rakam veya 2 büyük harf ve 6 rakamdan oluşur.
Accession number (RefSeq): Bütün bir RefSeq dizisine
atanmış kimlik numarasıdır. Sırasıyla iki büyük harf, bir
alt çizgi (_) ve 6 rakamdan oluşur (NT_123456).
* NT_123456 birleştirilmiş kontigler
* NM_123456 mRNA’lar (mRNA’dan oluşturulmuş
cDNA’lar)
* NP_123456 proteinler
* NC_123456 kromozomlar
 BLAST: (Basic Local Alignment Search Tool):
Aynı yada farklı organizmalar arasında nukleotid
yada protein dizisi karşılaştırılması ve benzer
bölgelerin araştırılması için kullanılan yüksek
hızda bir bilgisayar programı.
 CDS: Bir nukleotid dizisinin kodonları oluşturan
bölgesi yada kodlayan dizi.
 Conserved Sequence: Bir DNA molekülünde (bir
proteindeki Aa dizisinde) evrim süresince
değişmeden kalmış olan baz dizisi.
 Contig: Bir kromozomun üst üste çakışma
gösteren, klonlanmış farklı DNA parçaları grubu.
 Domain: Bir proteinin bağımsız olarak
katlanabildiği ve çalışılabildiği kabul edilen
parçası.
 EST (Expressed Sequence Tag): Bir Cdna
molekülünün, bir genin kimliği olarak
kullanılabilecek kısa bir parçası. Genlerin
konumlanmasından ve haritalanmasında
kullanılır.
 Motif: Protein dizisi içinde kısa, korunmuş bir
bölge. Motifler genellikle domainlerin yüksek
derecede korunmuş bölgeleridir.
DİZİ FORMATLARI
 1. GenBank DNA Dizi Formatı
 2. Avrupa Moleküler Biyoloji Laboratuvarı (EMBL ) Veri
Kütüphanesi Formatı
 3. FASTA Sekans Formatı
 4. National Biomedical Research Foundation /
Protein Information Resource Sekans Formatı
 5. Stanford Üniversitesi / Intelligenetics Sekans Formatı
 6. Genetik Bilgisayar Grubu ( GCG ) Sekans Formatı
 7. National Biomedical Research Vakfı / Protein
Information Resource’dan Elde edilen Sekans Dosyasının
Formatı
 8. Genetik Veri Çevresi ( GDE ) Sekans Formatı
 Gen Bank DNA Dizi Formatı: Girilen her dizinin
tanımlayıcı bilgileri verilir. Bu bilgiler her satırda
ilk bilgi olarak, her biri bir belirleyici ile birlikte
gruplara ayrılmış şekilde yazılır.
 Örneğin; referans için RF gibi,
 LOCUS lokusun ismi
 DEFINITION girişin tanımı
 ACCESSION orijinal kaynağın accession
numarası
 KEYWORDS bu girişin karşı referanslarının
yapılabilmesi için anahtar kelimeler
 SOURCE DNA’nın elde edildiği organizma
 Avrupa Moleküler Biyoloji Laboratuvarı Veri
Kütüphanesi Formatı (EMBL)
 ID veritabanındaki dizi için kimlik numarası
 AC dizinin başlangıcını gösteren accession
number
 DT girişin ve modifikasyonların tarihi
 KW anahtar kelimeler
 OS, OC kaynak organizma
FASTA
>AJ867261_Ovis_orientalis
CTGGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTATTATTCACGCCTGACTTA
CTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTAACACTCCCCCTCACATCAAA
CCTGAATGATACTTCCTATTTGCATACGCAATCTTACGATCAATCCCTAATAAACTAGGA
GGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACA
TCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTGTATTCTGAATCCTAGTA
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
>DQ097429|OA_MOR12_C
CTAGGTGCCATCCTACTGATCCTCATCCTCATGCTACTAGTACTATTTACGCCTGACCTA
CTCGGAGACCCAGACAACTACACCCCAGCAAATCCACTTAACACTCCCCCTCACATCAAA
CCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGA
GGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACA
TCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
GCTGACCTATTAACACTCACATGAATTGGAGGCCA
>DQ097430_OA_KAR15_C*
CTAGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTACTATTCACGCCTGACTTA
CTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTAACACTCCCCCTCACATCAAA
CCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGA
GGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACA
TCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
#Mega
MEGA
Title: Cytb_Konya sheep.txt
#AJ867261_Ovis_orientalis
CTGGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTATTATTCACGCCTGACTTA
CTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTAACACTCCCCCTCACATCAAA
CCTGAATGATACTTCCTATTTGCATACGCAATCTTACGATCAATCCCTAATAAACTAGGA
GGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACA
TCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTGTATTCTGAATCCTAGTA
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
#DQ097429|OA_MOR12_C
CTAGGTGCCATCCTACTGATCCTCATCCTCATGCTACTAGTACTATTTACGCCTGACCTA
CTCGGAGACCCAGACAACTACACCCCAGCAAATCCACTTAACACTCCCCCTCACATCAAA
CCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGA
GGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACA
TCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
GCTGACCTATTAACACTCACATGAATTGGAGGCCA
#DQ097430_OA_KAR15_C*
CTAGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTACTATTCACGCCTGACTTA
CTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTAACACTCCCCCTCACATCAAA
CCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGA
GGAGTCCTCGCCCTAATCCTCTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACA
TCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
#NEXUS
[TITLE: Cytb_Konya sheep.txt]
begin data;
NEXUS (1)
dimensions ntax=3 nchar=335;
format datatype=DNA missing=N gap=-;
matrix
AJ867261_Ovis_orientalis
CTGGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTATTATTCACGCCTGACTTACTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTA
ACACTCCCCCTCACATCAAACCTGAATGATACTTCCTATTTGCATACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCT
CTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTGTATTCTGAATCCTAGTA
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
DQ097429|OA_MOR12_C
CTAGGTGCCATCCTACTGATCCTCATCCTCATGCTACTAGTACTATTTACGCCTGACCTACTCGGAGACCCAGACAACTACACCCCAGCAAATCCACTTA
ACACTCCCCCTCACATCAAACCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCT
CTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
GCTGACCTATTAACACTCACATGAATTGGAGGCCA
DQ097430_OA_KAR15_C*
CTAGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTACTATTCACGCCTGACTTACTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTA
ACACTCCCCCTCACATCAAACCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCT
CTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
;
endblock;
begin assumptions;
options deftype=unord;
endblock;
NEXUS (2)
#NEXUS
[TITLE: Cytb_Konya sheep.txt]
begin data;
dimensions ntax=3 nchar=335;
format interleave datatype=DNA missing=N gap=-;
matrix
AJ867261 Ovis orientalis
CTGGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTATTATTCACGCCTGACTTACTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTA
DQ097429|OA_MOR12_C
CTAGGTGCCATCCTACTGATCCTCATCCTCATGCTACTAGTACTATTTACGCCTGACCTACTCGGAGACCCAGACAACTACACCCCAGCAAATCCACTTA
DQ097430_OA_KAR15_C*
CTAGGTGCCATCCTACTAATCCTCATCCTCATGCTACTAGTACTATTCACGCCTGACTTACTCGGAGACCCAGACAACTACACCCCAGCAAACCCACTTA
AJ867261_Ovis_orientalis
ACACTCCCCCTCACATCAAACCTGAATGATACTTCCTATTTGCATACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCT
DQ097429|OA_MOR12_C
ACACTCCCCCTCACATCAAACCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCT
DQ097430_OA_KAR15_C*
ACACTCCCCCTCACATCAAACCTGAGTGATACTTCCTATTTGCGTACGCAATCTTACGATCAATCCCTAATAAACTAGGAGGAGTCCTCGCCCTAATCCT
AJ867261_Ovis_orientalis
CTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGGAGCATAATATTCCGACCAATCAGTCAATGTGTATTCTGAATCCTAGTA
DQ097429|OA_MOR12_C
CTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
DQ097430_OA_KAR15_C*
CTCAATCCTAGTCCTAGTAATTATACCCCTCCTCCATACATCAAAGCAACGAAGCATAATATTCCGACCAATCAGTCAATGTATATTCTGAATCCTAGTA
AJ867261_Ovis_orientalis
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
DQ097429|OA_MOR12_C
GCTGACCTATTAACACTCACATGAATTGGAGGCCA
DQ097430_OA_KAR15_C*
;
endblock;
begin assumptions;
options deftype=unord;
endblock
GCCGACCTATTAACACTCACATGAATTGGAGGCCA
Roehl
31445911223
8388324580
64233
DNA FORMATI
H_1 GATCTCAAGGC 1
H_2 AGCTCTGGAAT 1
H_3 AACCTCGGAAC 1
MORFOLOJİ/AFLP/RFLP/RAPD/ISSR/SSR
FORMATI
1010101010101010101010
BİR DİZİ FORMATINI DİĞERİNE
DÖNÜŞTÜRMEK
 Dizi hizalamaları çeşitli metin-tabanlı dosya
formatlarında saklanabilir, bunların çoğu ilk
olarak belli bir hizalama programı veya
uygulaması ile birlikte geliştirilmiştir.
 Çoğu Web-temelli araçlar sınırlı sayıda girdi ve
çıktı format seçeneği verirler. Örneğin FASTA
formatı ve GenBank formatı gibi ve program
çıktısı genelde kolayca değiştirilemez.
 Çeşitli format dönüştürme programları
mevcuttur, bunlardan READSEQ ve EMBOSS
gibi bazılarının grafik arayüzü veya komut satır
arayüzü vardır.
 Buna karşın BioPerl , BioRuby gibi program
paketlerinin buna olanak veren kendi
fonksiyonları vardır
Yaygın Olarak Kullanılan Bilgisayar
Programları:
 Programlar hakkında genel bilgiye geçmeden evvel
bir konunun altını çizmekte fayda vardır.
 Genellikle filogenetik alanında çalışan
akademisyenler ile bu alanda program geliştirenler
ezici çoğunluk ile MAC kullanmaktadırlar.
 Her ne kadar programların PC versiyonları mevcut
ise de MAC versiyonları her zaman daha ileri ve üst
sürümdürler.
 Filogenetik ağaçların eldesinde en yaygın kullanılan
sadece 3 program hakkında bilgi vereceğiz.
 Ne var ki bu programların önerdikleri ağaçları
bilgisayarınızda görüntülemenizi sağlayan baska bir
program daha vardır. Bu da Treeview programıdır.
 1. PAUP (Phylogenetic Analysis Using Parsimony): Florida
Eyelet Üniversitesi’nden bir Akademisyen tarafından
geliştirilen programın en son 4.0 beta versiyonu piyasaya
sürlümüştür. Program ücretsiz değildir. Online olarak
ulaşılabilecek oldukça kapsamlı bir elkitabı vardır.
 2. PHYLIP: İnternet üzerinden kullanımı ücretsizdir.
Parsimony, farklılık matrisleri , maximum likelihood, ve bir
çok farklı metodla ağaç eldesine olanak tanımakla klamayıp
aynı zamanda değişik bir çok veri tipini
kullanabilmektedir(DNA, RNA, Protein, restriksüyon
bölgeleri, gen frekansları vs.) .
 3. MrBayes: Adından da anlaşılacağı üzere Bayes istatistiği
kullanılarak filogenetik ağaç elde etmede kullanılan
bilgisayar programıdır. Bu program ücretsiz olarak
internetten indirilip kullanılabilmektedir.
PAUP (Phylogenetic Analysis Using Parsimony)
 Paup bir bilgisayar programı olup parsimoni kriteri altında
filogenetik hipotez oluşturmakta kullanılır. Parsimoni metodu bir
veri matrisinden çıkarılması muhtemel ağaçları değerlendirerek,
minimum uzunluktaki ağaçları bulmaya yarayan bir algoritma ile
çalışır.
 Belli karakter tiplerini kullanarak ağaç oluşturmaya yarayan
çeşitli algoritmalar geliştirilmiştir. PAUP programı, bütün bu
algoritmaları kapsayan genel bir algoritma ile çalışır. Kullanıcı
istediği herhangi bir karakter tipini ya da tiplerini harmanlayarak
aynı anda analiz etme seçeneğine sahiptir.
Paup programı kullanılarak elde edilmiş bir
filogenetik ağacın Treeview programındaki
görüntüsü
Bir genin DNA dizisi nasıl bulunur?
NEXUS
 Number nexus
 Takson bloğu
 Karakter bloğu takson etiketleri vardır.
 Nexus bir format çeşididir.
 Nexus’ un formatının özelliği noktalı virgülleri herbirini gösterir ve iki
noktalı virgül arasında END yazısı yazılmışsa o bloğun bittiğini gösterir.
 Nexus formatı kulanılaraak Paup programında filogenetik analiz yapılır ve
filogenetik ağaçlar elde edilir.
MATRİX
 Veri matriksinin bittiğinide noktalı virgül sonuna END yazılır.
 Kaynaklar 
 www.phlogeny.fr/version2_cgi/data_converter.cgi
 http://www.ncbi.nlm.nih.gov/
 DNA dizilerinin analiz icin nexus formatina cevrimi
YARDIMLARINDAN DOLAYI FATİH ÇOŞKUN
HOCAMA TEŞEKKÜR EDERİM…
Beni dinlediğiniz için teşekkür
ederim 
Hazırlayan :AYŞEGÜL ÇAMDERELİ
200920102070
2.ÖĞRETİM B-GRUBU

similar documents