Slide 1 - Laboratório de Polimorfismos Genéticos

Report
UNIVERSIDADE FEDERAL DE SANTA CATARINA
CENTRO DE CIÊNCIAS BIOLÓGICAS
LABORATÓRIO DE POLIMORFISMOS GENÉTICOS
Quando?
De quem?
Como?
Tratamentos?
Quanto mais fresco melhor!
Quantidade aceitável
Boa conservação
EPI!
Contenção!
Extração
de DNA
De onde podemos extrair DNA?
•
•
•
•
•
•
Sangue
Tecidos
Células de cultura
Extração plasmídeos de células bacterianas
Purificação de DNA de gel
...
Material de pacientes e controles - Lapoge
Sangue total
Buffy coats
Amostras de tecido
Objetivos?
Objetivos
PCR – tamanho?
Genotipagem?
Sequenciamento?
Quantificação de RNA - Expressão?
Integridade
Pureza
Quantidade
Fundamentos
1. Lisar eritrócitos (choque osmótico)
2. Lisar leucócitos (detergentes)
3. Inativar DNAse (quelante -EDTA)
4. Precipitar/degradar proteínas (sais/proteinase)
5. Precipitar DNA (etanol)
6. Reidratação do DNA em água ou tampão
Principais Métodos
1.Fenol-Cloróformio
2.Salting-out
3. Kits com colunas
Fenol-Cloróformio
1. Lise I: eritrócitos
2. Lise II: leucócitos
3. Fenol-clorofórmio
4. Precipitação etanol
•
•
•
•
•
Barato
Simples
Boa quantidade
Boa qualidade
Estabilidade do DNA
• Contaminação da amostra
por fenol
• Reagentes tóxicos!
Salting-out
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S036505962008000300002
Barato
Simples
Boa quantidade
Boa qualidade
Não tóxico
Estabilidade do DNA?
Sais contaminantes
MUITO Simples
Boa quantidade
Boa qualidade
Não tóxico
Caro
Estabilidade do DNA
Extração de RNA: Análises de expressão
Similar a extração de DNA
Protocolo bem mais cuidadoso
Molécula muito mais instável
Amostra pode ser bem conservado em TRIzol,
RNAlater, etc.) - snapshot
• É preciso separá-la do DNA
•
•
•
•
•
•
•
TRIzol
RNAlater
Kit com colunas
TRIzol
1. Lise I: eritrócitos
2. TRIzol (fenol-guanidina)
3. Clorofórmio
4. Precipitação etanol
Pode ser usado para extração
de RNA, DNA e Proteínas!
Kit com colunas
Transcrição reversa
(Nanodrop)
(Quebit)
Espectrofotômetro - Nanodrop
260/230 ~1,8
260/230 ~2,0
260nm – DNA/RNA
280nm – proteína, fenol,..
230nm – contaminantes (carboidratos, fenol,..)
Armazenar?
Estoque
DNA: -20◦C
Uso (diluído)
RNA: -80◦C
Enzimas
de
restrição
• Endonucleases produzidas por bactérias para se
defender de vírus.
• Quebram o DNA em fragmentos menores, não
infecciosos.
• Reconhecem sítios específicos (sítios de restrição)
no genoma e a corta.
• São conhecidos mais de 3000 enzimas
Fragmentação DNA!
Clonagem!
Genotipagem!
...
RFPL: Polimorfismos de comprimento do
fragmento de restrição
Detecção dos polimorfismos de nucleotídeos únicos
(SNPs – single nucleotide polymorphisms).
Os primers utilizados na PCR flanqueiam a região
que contém, ou não, o sítio de clivagem
reconhecido pela enzima de restrição utilizada.
O produto da PCR é posteriormente submetido à
ação da enzima de restrição.
3´ CGTAAATCTATACGAGAATTCACGTACGTA5´
2
5´ GCATTTAGATATGCTCTTAAGTGCATGCAT3´
3´ CGTAAATCTATACGAGTATTCACGTACGTA5´
1
5´ GCATTTAGATATGCTCATAAGTGCATGCAT3´
2/2
2/2 1/2
2/2
2/2 1/1
1/2
1/2 1/1
1/1

similar documents