Sequenciamento de nova geração: plataforma SOLiD

Report
Plataforma SOLiD
ICB –USP
Disciplina: Bioinformática Aplicada ao Estudo de Doenças Parasitárias
Jaques Franco
Carvalho et al ,2010
Andreonte ,2011.
Roche-454
Illumina-Solexa
Base -code
c
c
ATGTCGTGCTGCCGAGCGGAGGTGAATGAGCCAGTAACTCCCAGC
TCCGCTTCATCATTGGAGTCTGACG
ABI-SOLiD
T012301123321023021123021
001232332
Color-code
SOLiD 4
SOLiD 5500
Reação é catalisada por uma DNA ligase
Nesse método os fragmentos de DNA são
gerados e ligados aos adaptadores P1 e P2
que se ligam especificamente a uma
microesfera
Ciclo de
hibridização
a cada 35pb
Código
0
1
2
3
Fluorocromos
FAM
Cy3
TXR
Cy5
AA
AC
AG
AT
CC
CA
GA
TA
GG
GT
CT
CG
TT
TG
TC
GC
Saída do Sequenciador
Os arquivos que representam as sequências obtidas estão no formato
“csfasta”.
Valor da qualidade associada a cada transição de base das
sequências lidas estão no formato “qual”.
Pipeline De novo
É um conjunto de softwares utilizados para montagens de genomas onde não se
conhece a referência, ele faz a montagem dos “reads” e gera sequências maiores
como contigs e scaffolds.
Limitações
1.Leituras curtas de 35 pares de bases
2. Regiões repetitivas
3. Construção de bibliotecas
4. Custo das máquinas
5. Erros de montagem
6. Processamento, análise e interpretação de dados
8. DNA barcode

similar documents