Course overview and SSR

Report
FALL 2014
HORT6033
MOLECULAR
PLANT BREEDING
Instructor: Ainong Shi
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 1 (08/25/2014)
I. Class Overview (5 min)
II.Class Estimation Questions and
Answers (15 min)
III.SSR Marker and Tools (25 min)
IV. Homework (3 min)
V.Questions (2 min)
Fall 2014 HORT6033
Molecular Plant Breeding
Instructor: Dr. Ainong Shi
Phone: 479-575-2670 (o), 479-879-0159 (c)
Email: [email protected]
Office: PTSC 321
Office Hours: Please email to Ainong Shi at [email protected] to set up
an appointment. But feel free to call or stop by.
Class Hours: MWF 9:40 – 10:30 am, August 25 – December 19, 2014
Classroom: UAF campus AGRI 0301A
Lab Location: PTSC 322, open: 7 days a week
Lab Assistant: Dr. Jianbing Ma ([email protected])
Guest Instructor: Dr. John R. Clark, Dr. Pengyin Chen, Dr. Richard
Esten Mason, Dr. Andy Pereira, Dr. Subodh Srivastava, and
Dr. Weiguo Lu ………..
Student Info
Name
Major
Email
Marlovi Andrea Acuna Galindo
Abeer Muhammedali Jasim Al-Nasrawi
FNU Anuj Kumar
Jessica L Chitwood
Marcos Paulo Da Silva
Mirta Beatriz Dalzotto
Terrence James Frett
Clinton Philip Greub
Ashley Elizabeth Humphreys
Avjinder Singh Kaler
Mariola Klepadlo
Laura Melissa Lara Santisteban
Jennifer Anne Lewter
Cindy Massiel Lopez Ramirez
Dennis Nicuh Bulusan Lozada
Reiofeli Algodon Salas
Shilpa Singh
Vijay Singh
Brant Michael Smith
Janithri S. Wickramanayake
CSES
CEMB
CSES
HORT
CSES
CSES
PLSC
CEMB
ENTO
CSES
CSES
CSES
PLSC
CSES
CEMB
CSES
CEMB
CSES
PLPA
ENTO
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
Name
Jianbing Ma
Weiguo Lu
Haizheng Xiong
Jun Qin
Long Yan
Maria Nelly Arguello Blanco
Liliana Florez-Palacios
Email
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
[email protected]
Register
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture
Lab
Project
Tools, Homework, Reading, and Research
Fall 2014 HORT6033
Syllabus of Molecular Plant Breeding
I. Course Description
II. Course Objective and Outcome
III. Grading
IV. Class Schedule
V. Software and Tools Download and Installation
VI. Quiz and Examination (30%)
VII. Assignment (homework, computer tools, and reading) (30% +
5% bonus)
VIII. Lab, Project, Report, Presentation, and Article Reading (30%
+ 10% bonus)
IX. Reading Materials
Download Syllabus at
http://comp.uark.edu/~ashi/MB/HORT6033_syllabus.pdf
Course Web: http://comp.uark.edu/~ashi/MB
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 1 (08/25/2014)
II. Class Estimation Questions and Answers
1. Quiz
This is just an estimation to test which level each student has
before the class, in order to divide students into groups.
Download the questions at
http://comp.uark.edu/~ashi/MB/HORT6033_Estimation_question.pdf
2. Quiz discussion
http://comp.uark.edu/~ashi/MB/goodday/HORT6033_estimation_que
stion_answer_08252014.pdf
III. SSR Marker and Tools
•
SSR is repeating sequences of 2-5 (most of them) base pairs of DNA
such as (AT)n, (CTC)n, (GAGT)n, (CTCGA)n
•
SSR is called Microsatellites
•
SSR usually is co-dominant
•
SSR can be used:






Fingerprinting
Genetic diversity
Genetic mapping
Association mapping
Marker-assisted selection
Genome-wide selection etc.
Left Figure:
Allele #1: (CA)11 [SSR motif (CA) repeat 11 times]
Allele #2: (CA)13
Allele #3: (CA)16
After PCR, the DNA sample with Allele #1, #2, #3
showing different size DNA fragment and the
different combination of allele #1, #2, and #3
With different pattern with co-dominant.
(image from http://www.cdfd.org.in/)
Example for SSR (AT)
1. SSRLocator
 SSR discovery for large DNA sequences, and also
for primer design and PCR simulation (Maia et al.
2008. Int J Plant Genomics. 2008:412696)[PDF]
 Tools: from Plant Genomics and Breeding Center Federal University of Pelotas – Brazil ( ufpel.edu.br ).
 Example: cowpea_EST_1_0693.fasta (linked)
http://www2.ufpel.ed
u.br/faem/fitotecnia/
fitomelhoramento/fal
econosco.html
1. SSRLocator - running
 Install SSRLocator in C: as showing C:\SSRLocatorI
 Copy your data file with fasta format (.fasta) into
the SSRLocatorI folder such as
“cowpea_EST_1_0693.fasta”.
 Open SSRLocatorI.exe
 Format file to SSRLocator Standart in the “Create
File” button. Save a new file called
“cowpea_EST_1_0693format.fasta”
 And more …….
1. SSRLocator - Output
The SSR motif (AT) creates various repeats from 12 to 20
among the five cowpea samples (below Loci in the
Table). Primer pairs are designed and expected PCR size
are estimated ranged 211 to 381 bp. The polymorphism
can be used as marker – SSR marker !
Contig
Loci
Start_SSR1
End_SSR1
FG938745_UCRVU09_UCR_707
(AT)20
239
278
FG908248_UCRVU08_CCNS5607_IT97K-461-4
(AT)13
204
229
FG875445_UCRVU07_CCNP10713_UCR_779
(AT)12
205
228
FG850994_UCRVU05_CCNN17188_IT84S-2049
FG815463_UCRVU04_CCNI2988_524B
(AT)19
(AT)15
200
216
237
245
Contig
Foward
TM
Foward
Reverse
TM
Reverse
Product
Size
FG938745
AACAGCTTAGAGCGTGAAAG
55.1
TTTCGATGTGTGAGAAATGA
55.1
381
FG908248
CAGCTGTTAAACCACACAAA
54.9
TTTCGATGTGTGAGAAATGA
55.1
213
FG875445
CAGCTGTTAAACCACACAAA
54.9
TTTCGATGTGTGAGAAATGA
55.1
211
FG850994
CAGCTGTTAAACCACACAAA
54.9
TTTCGATGTGTGAGAAATGA
55.1
224
FG815463
CAGCTGTTAAACCACACAAA
54.9
TTTCGATGTGTGAGAAATGA
55.1
216
2. MEGA and BioEdit
MEGA 6 and BioEdit can be used to view SSR motifs
among DNA samples (above from MEGA 6 and the bottom from BioEdit)
3. BatchPrimer3
BatchPrimer3 is the tool for primer design including
Primers for SSRs.
It can be used for SSR discovery as well.
Tool website:
http://batchprimer3.bioinformatics.ucdavis.edu/
• Web tool:
http://batchprimer3.bioinformatics.ucdavis.edu/cgibin/batchprimer3/batchprimer3.cgi
• An example cowpea_EST_1_0693.fasta”.
•
•
•
•
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 1 (08/25/2014)
IV. Homework
1.
Download cowpea ESTs from GenBank
2.
Download and Install software SSRLocator
3.
Read SSRlocator manual and SSR articles
4.
Download MEGA 6, BioEdit and manuals
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 1 (08/25/2014)
V. Homework
1.
Download cowpea ESTs from GenBank
V. Homework
2. Download and Install software SSRLocator
 Download the tools from Plant Genomics and
Breeding Center - Federal University of Pelotas –
Brazil ( ufpel.edu.br ). The tools for Windows
Seven 32 bits should still work for Windows 64.
You should download FireBird (database for
store SSR data) and SSRLocator. The In the web
page, you can see the link for Install Instruction
and User Guide. You should also download or
view the instruction for FireBird and SSRLocator,
and also for User Guide!
V. Homework
3. Read SSR locator manual and SSR articles
Manual download!
SSR article:
Dear Students:
Please read and download homework and quiz at
http://comp.uark.edu/~ashi/MB/molecularBreeding_homework.html !
THANKS!

similar documents