NEBcutter - University of Pittsburgh

Report
Primer Design &
Restriction Analysis
2nd April 2014
Carrie Iwema, PhD, MLS, AHIP
Information Specialist in Molecular Biology
Health Sciences Library System
University of Pittsburgh
[email protected]
http://www.hsls.pitt.edu/molbio
Goals:

PCR primer construction & analysis

Restriction digestion & mapping
http://www.hsls.pitt.edu/molbio
Tools:

Primer Analysis & Design




NetPrimer
Primer3Plus
Primer-BLAST
Restriction Mapping


NEBcutter
Webcutter
http://www.hsls.pitt.edu/molbio
Primer Analysis & Design
A little something to get you in the mood…
http://www.hsls.pitt.edu/molbio
Polymerase Chain Reaction (PCR)



very simple
exponential amplification
similar to natural DNA replication
1983-Kary Mullis
The primary reagents, used in PCR are:




Template DNA–DNA sequence to amplify
DNA nucleotides–building blocks for new DNA
Taq polymerase–heat stable enzyme catalyzes new DNA
Primers–single-stranded DNA, ~20-50 nucleotides,
complimentary to a short region on either side of template DNA
http://www.hsls.pitt.edu/molbio
Polymerase Chain Reaction (PCR)
1.
Raise temperature (9498), denature DNA
strands
2.
Lower temp (50-65),
anneal primers
3.
Increase temp (72-80),
allow time for extensions
4.
Repeat process 25-40X
http://www.hsls.pitt.edu/molbio
Things to consider for primer design…

Primer-Dimer formation

Secondary Structures in Primers

Illegitimate Priming in Template DNA
due to repeated sequences

Incompatibility with PCR conditions
SOURCE: NCBI
http://www.hsls.pitt.edu/molbio
Primer-Dimer formation



SOURCE: NCBI
homology within a primer (self dimer) or between the sense
and anti-sense primer (cross dimer)
bonding of the two primers, increasing primer-dimer artifact
and reducing product yields
particularly problematic when the homology occurs at the
3' end of either primer
http://www.hsls.pitt.edu/molbio
Self Dimer (example)
SOURCE: NCBI
internal
dimer
3’ end dimer


The primer sequence is ATCAGCTGTAGAT
It forms 2 dimers:


internal dimer where 3rd-8th bases of primer in 5‘3' (starting
from 5') bond with 6th-11th bases (starting from 3') when primer is
placed in reverse direction
3' end dimer where the last 3 bases (starting from 5') of primer
placed in 5‘3' direction bond with last three base (starting from
3') placed in reverse direction.
http://www.hsls.pitt.edu/molbio
Cross Dimer (example)
3’ cross dimer



Sense primer sequence is ATCAGCTGTAGAT
Anti-sense primer sequence is ATAGTGTAGAT
Forms one cross dimer at the 3' end
SOURCE: NCBI
http://www.hsls.pitt.edu/molbio
Secondary Structure in Primers

Hairpin loop
 formed when primer folds back upon itself
 held in place by intramolecular bonding
 can occur with as few as 3 consecutive homologous bases
 stability measured by the free energy
The free energy of the loop is based upon the energy of the
intramolecular bond and the energy needed to twist the DNA
to form the loop.
 If free energy >0, the loop is too unstable to interfere with
the reaction
 If free energy <0, the loop could reduce the efficiency of
amplification
http://www.hsls.pitt.edu/molbio
Hairpin Loop (example)
SOURCE: NCBI
3’ end hairpin
internal
hairpin

The primer sequence is ATCGATATTCGAAGAT

It forms two hairpins:


3' end hairpin where the primer folds back upon itself and first
and last 3 bases bond together
internal hairpin where 2nd-5th and 9th-12th bases bond together
http://www.hsls.pitt.edu/molbio
Basic Primer Analysis & Design Software

NetPrimer


Primer3Plus


http://www.premierbiosoft.com/netprimer/
http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi
Primer-BLAST

http://www.ncbi.nlm.nih.gov/tools/primer-blast/
http://www.hsls.pitt.edu/molbio
NetPrimer

http://www.premierbiosoft.com/netprimer/

From PREMIER Biosoft
Free
Major features:








Primer properties: Tm , molecular weight, GC%, optical
activity (both in nmol/A260 & µg/A260), DG, 3' end stability,
DH, DS, and 5' end DG
Secondary structures: Hairpins, dimers, cross dimers,
palindromes, repeats and runs
Primer rating: Quantitative prediction of the efficiency of a
primer
Comprehensive report: Prints complete primer analysis for
an individual primer or primer pair
Primer pairs: Analyze individual primers or primer pairs
Comprehensive help: Details all the formulas and
references used in primer analysis algorithm
http://www.hsls.pitt.edu/molbio
NetPrimer
Enter sequence here
http://www.hsls.pitt.edu/molbio
NetPrimer—sense primer
http://www.hsls.pitt.edu/molbio
NetPrimer—help
http://www.hsls.pitt.edu/molbio
NetPrimer—theories & formulas
http://www.hsls.pitt.edu/molbio
NetPrimer—antisense primer
http://www.hsls.pitt.edu/molbio
NetPrimer—antisense hairpin
The most negative (i.e., most
stable) DG is used for
calculating the rating.
http://www.hsls.pitt.edu/molbio
NetPrimer—antisense dimer
http://www.hsls.pitt.edu/molbio
NetPrimer—cross dimer
http://www.hsls.pitt.edu/molbio
NetPrimer—3’ & 5’ stability
An ideal primer has a stable 5' end
and an unstable 3' end.
Unstable 3’ = limits bonding to false
priming sites. The lower this value,
numerically, the more liable the primer
is to show secondary bands.
less negative = less false priming.
Stable 5’ = called the GC Clamp, it
increases bonding to the target site.
The lower this value, numerically, the
more efficient is the primer.
more negative = better bonding.
http://www.hsls.pitt.edu/molbio
NetPrimer—rating
The rating of a primer provides a quick way of
measuring the predicted efficiency of a primer
as well as choosing between closely matched
primers. The higher the rating of a primer,
the higher its amplification efficiency.
http://www.hsls.pitt.edu/molbio
NetPrimer—DG
DG = DH – T * DS = free energy of the primer
DH = enthalpy (internal energy) of primer
T = temperature
DS = entropy (unavailable energy) of primer
Example: primer sequence = ATTCGCGGATTAGCCGAT
DG = -154500 cal/mol – (298.15 * -403 cal/°K/mol) = -34.35 kcal/mol
Rating = 100 + [(DG dimer * 1.8) + (DG hairpin * 1.4)]
Example: 100 + [(-10.36 kcal/mol * 1.8) + (-3.28 * 1.4)]
100 + [-18.648 + -4.592]
100 + -23.24
76.76
The higher the rating, the better!
http://www.hsls.pitt.edu/molbio
NetPrimer—practice primers
Rank these primers with attention to
rating, 5’ end DG, and 3’ end stability
1.
2.
3.
4.
5.
6.
atgtgcgaggagaaagtgct
acaaaccctggacttgcatc
cgacttgtcccaggtgtttt
ctgaaaccattggcacacac
ggctgtgaacatggacattg
ggctgaagccaaagctacac
http://www.hsls.pitt.edu/molbio
NetPrimer

Ideal for checking primers

To create primers, try Primer3Plus
http://www.hsls.pitt.edu/molbio
Primer3Plus

http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi

Select primer pairs to detect a given template sequence

Targets and included/excluded regions can be specified

Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the
WWW for general users and for biologist programmers. In: Krawetz
S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in
Molecular Biology. Human Press, Totowa, NJ, pp 365-386
http://www.hsls.pitt.edu/molbio
Primer3Plus
http://www.hsls.pitt.edu/molbio
Primer3Plus
Design PCR primers to amplify sub region
of the sequence (600bp-2600bp) with
product size 1800bp-2000bp.
http://www.hsls.pitt.edu/molbio
Primer3Plus—getting started
click here to retrieve sample
sequence, then copy/paste into box
http://www.hsls.pitt.edu/molbio
Primer3Plus
Design PCR primers to amplify sub region of the sequence
(600bp-2600bp) with product size 1800bp-2000bp.
http://www.hsls.pitt.edu/molbio
Primer3Plus
Design PCR primers to amplify sub region of the sequence
(600bp-2600bp) with product size 1800bp-2000bp.
http://www.hsls.pitt.edu/molbio
Primer3Plus—results
http://www.hsls.pitt.edu/molbio
Primer3Plus—results
http://www.hsls.pitt.edu/molbio
Primer3Plus—results
http://www.hsls.pitt.edu/molbio
Primer3Plus—Primer3Manager
http://www.hsls.pitt.edu/molbio
Primer3Plus—check primers
http://www.hsls.pitt.edu/molbio
Primer3Plus—check primers
http://www.hsls.pitt.edu/molbio
Primer3Plus—primer info
http://www.hsls.pitt.edu/molbio
Primer3Plus—BLAST primers
http://www.hsls.pitt.edu/molbio
Primer3Plus—BLAST primers
http://www.hsls.pitt.edu/molbio
Primer3Plus—check w/NetPrimer
How good are these primers?
Analyze with NetPrimer!
http://www.hsls.pitt.edu/molbio
Primer3Plus—NetPrimer sense
Left (F) primer
http://www.hsls.pitt.edu/molbio
Primer3Plus—NetPrimer sense
http://www.hsls.pitt.edu/molbio
Primer3Plus—NetPrimer antisense
Right (R) primer
http://www.hsls.pitt.edu/molbio
Primer3Plus—NetPrimer antisense
http://www.hsls.pitt.edu/molbio
Primer-BLAST

http://www.ncbi.nlm.nih.gov/tools/primer-blast/

Combines primer design (Primer3) and a specificity check
(BLAST)

Can also be used w/pre-designed primers

ref: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3412702/
http://www.hsls.pitt.edu/molbio
Primer Design Tips

RT-PCR (to avoid unwanted amplification of genomic DNA)

Primer pair should span an intron
Or


SNP issues


One of the primers should be at exon-exon junction
May cause mismatch, so pick primers outside of this region
qPCR

Specificity of amplification (amount of PCR product = fluor intensity)
http://www.hsls.pitt.edu/molbio
Primer-BLAST
click here to retrieve
sample sequence, then
copy/paste into box
http://www.hsls.pitt.edu/molbio
Primer-BLAST results
http://www.hsls.pitt.edu/molbio
HSLS MolBio Primer Design Tools
http://www.hsls.pitt.edu/molbio
Finding Primer Resources…
search.HSLS.MolBio
http://www.hsls.pitt.edu/molbio
More Primer Databases
http://www.hsls.pitt.edu/molbio
Restriction Mapping
www.biologyreference.com
http://www.hsls.pitt.edu/molbio
Restriction Mapping—for your sequence






Determine the # of restriction sites
Determine the nucleotide position of each cut
List the enzymes that do not cut
List the enzymes that cut only once
Graphical representation of the restriction sites
Textual representation of the restriction sites
http://www.hsls.pitt.edu/molbio
Restriction Mapping Tools

NEBcutter


http://tools.neb.com/NEBcutter2/index.php
Webcutter

http://bio.biomedicine.gu.se/cutter2/
http://www.hsls.pitt.edu/molbio
NEBcutter V2.0



From New England BioLabs
Free
Major features:




Takes a DNA sequence and finds the large, non-overlapping
open reading frames using the E. coli genetic code and the
sites for all Type II and commercially available Type III
restriction enzymes that cut the sequence just once.
By default, only enzymes from NEB are used, but other sets
may be chosen.
Further options appear in the output.
Maximum size of input file = 1 MB; maximum sequence
length = 300 KB.
http://www.hsls.pitt.edu/molbio
NEBcutter
http://www.hsls.pitt.edu/molbio
NEBcutter—program guide
http://www.hsls.pitt.edu/molbio
NEBcutter
http://www.hsls.pitt.edu/molbio
NEBcutter—help
http://www.hsls.pitt.edu/molbio
NEBcutter—getting started
click here to retrieve sample
sequence, then copy/paste into box
http://www.hsls.pitt.edu/molbio
NEBcutter—restriction map
http://www.hsls.pitt.edu/molbio
NEBcutter—cutters
http://www.hsls.pitt.edu/molbio
NEBcutter—zoom in
http://www.hsls.pitt.edu/molbio
NEBcutter—zoom in more
http://www.hsls.pitt.edu/molbio
NEBcutter—zoom in more
http://www.hsls.pitt.edu/molbio
NEBcutter—custom digestion
Get digestion map with SmlI and XbaI
http://www.hsls.pitt.edu/molbio
NEBcutter—select enzymes
http://www.hsls.pitt.edu/molbio
NEBcutter—custom digestion map
View gel
http://www.hsls.pitt.edu/molbio
NEBcutter—agarose gel view
http://www.hsls.pitt.edu/molbio
NEBcutter—ORF sequence
Find restriction enzymes that
will excise the selected
portion of the sequence.
http://www.hsls.pitt.edu/molbio
NEBcutter—ORF sequence
http://www.hsls.pitt.edu/molbio
NEBcutter—flanking sites
http://www.hsls.pitt.edu/molbio
NEBcutter—ORF sequence
http://www.hsls.pitt.edu/molbio
NEBcutter—silent mutagenesis
http://www.hsls.pitt.edu/molbio
NEBcutter—excise a user-defined sequence
http://www.hsls.pitt.edu/molbio
NEBcutter—excise a user-defined sequence
http://www.hsls.pitt.edu/molbio
NEBcutter—enzyme information
http://www.hsls.pitt.edu/molbio
NEBcutter—enzyme information
http://www.hsls.pitt.edu/molbio
NEBcutter—REBASE enzyme page
http://www.hsls.pitt.edu/molbio
REBASE—the restriction enzyme database
http://www.hsls.pitt.edu/molbio
NEBcutter—enzyme information
http://www.hsls.pitt.edu/molbio
NEBcutter—methylation sensitivity
http://www.hsls.pitt.edu/molbio
NEBcutter—generate a vector map
http://www.hsls.pitt.edu/molbio
NEBcutter—generate a vector map
http://www.hsls.pitt.edu/molbio
NEBcutter—generate a vector map
http://www.hsls.pitt.edu/molbio
Sample DNA Sequence
You have cloned this
mouse sequence:
Answer the questions
on the following page
using NEBcutter.
TGCAGTTTCTATGCAGTTGGTAAAAAGATGCAAAGGAGATGGGAAGGTTGGGAAGGTAAGCCCCACCTCT
GAGAACAGAGGCTGGGGTCCAGGCCTGTGGGTGCAAAGGTGCCTCAGCATAGCCAGCATCAGCACACGCA
AACCCACTGCCCAAATTTGGGCTCAGGGTTGGCCATTTGCTAGTTCTGCTGCCCTCTTAAGATCTGACTG
CCAAATAAATCATCCTCATGTCC
ATTGGCGGATCCTGACTACACGCTGTCTTTCTGGCGGAATGGGAAAGTCCAGCACTGCCGCATCCACTCCC
GGCAGGATGCT
GGGACTCCTAAGTTCTTCTTGACAGATAACCTTGTCTTTGACTCTCTCTATGACCTCATCACACATTATC
AGCAAGTACCCCTGCGCTGCAATGAGTTTGAGATGCGCCTTTCAGAGCCTGTTCCACAGACGAATGCCCA
TGAGAGCAAAGAGTGGTACCACGCAAGCCTGACTAGAGCTCAGGCTGAACATATGCTGATGCGAGTGCCC
CGGGATGGGGCCTTCCTGGTGCGGAAACGCAATGAGCCTAACTCATATGCCATCTCTTTCCGGGCTGAGG
GAAAGATCAAGCACTGCCGAGTACAGCAGGAAGGCCAGACAGTGATGCTGGGGAACTCTGAGTTTGACAG
CCTGGTTGACCTCATCAGCTACTATGAGAAGCACCCCCTGTACCGCAAAATGAAGCTACGCTACCCCATC
AACGAGGAGGCACTGGAGAAGATCGGGACAGCTGAACCCGATTATGGGGCACTATACGAGGGCCGCAACC
CTGGTTTCTATGTGGAGGCAAACCCTATGCCAACTTTCAAGTGTGCAGTAAAAGCCCTCTTCGACTACAA
GGCCCAGAGAGAGGATGAGCTGACCTTCACCAAGAGTGCCATCATCCAGAATGTGGAAAAGCAAGATGGT
GGCTGGTGGCGAGGGGACTATGGTGGGAAGAAGCAGCTGTGGTTCCCCTCAAACTATGTGGAAGAGATGA
TCAATCCAGCAGTCCTAGAGCCTGAGAGGGAGCACCTGGATGAGAACAGCCCACTGGGGGACTTGCTGCG
AGGGGTCTTAGATGTGCCAGCTTGTCAGATCGCCATCCGTCCTGAGGGCAAAAACAACCGGCTCTTCGTC
TTCTCCATCAGCATGCCATCAGTGGCTCAGTGGTCCCTGGATGTTGCAGCTGACTCACAGGAGGAGTTAC
AGGACTGGGTGAAAAAGATCCGTGAAGTTGCCCAGACTGCAGATGCCAGGCTCACTGAGGGAAAGATGAT
GGAGAGGAGGAAGAAGATCGCCTTGGAGCTCTCCGAGCTTGTGGTCTACTGCCGGCCCGTTCCCTTTGAT
GAAGAGAAGATTGGCACAGAACGTGCTTGTTACCGGGACATGTCCTCCTTTCCGGAAACCAAGGCTGAGA
AGTATGTGAACAAGGCCAAAGGCAAGAAGTTCCTCCAGTACAACCGGCTGCAGCTCTCGCGCATCTACCC
TAAGGGCCAGAGGCTAGACTCCTCCAATTATGACCCTCTGCCCATGTGGATCTGCGGTAGCCAGCTTGTA
GCACTCAATTTCCAGACCCCAGACAAGCCTATGCAGATGAACCAGGCCCTCTTCATGGCTGGTGGGCATT
GTGGCTATGTGCTGCAGCCAAGCACCATGAGAGACGAAGCCTTTGACCCCTTTGATAAGAGCAGTCTCCG
AGGTCTGGAACCCTGTGTCATTTGCATTGAGGTGCTGGGGGCCAGGCATCTGCCGAAGAATGGCCGGGGT
ATTGTGTGTCCTTTTGTGGAGATTGAGGTGGCTGGGGCTGAGTACGACAGCACCAAGCAAAAGACGGAGT
TTGTAGTGGACAACGGACTGAACCCTGTGTGGCCTGCTAAGCCCTTCCACTTCCAGATCAGTAACCCAGA
GTTTGCCTTTCTGCGCTTTGTGGTGTATGAGGAAGACATGTTTAGTGACCAGAACTTCTTGGCTCAGGCT
ACTTTCCCAGTAAAAGGCCTGAAGACAGGATATAGAGCAGTGCCTTTGAAGAACAACTACAGTGAAGACC
TGGAGTTGGCCTCCCTGCTCATCAAGATTGACATTTTCCCTGCTAAGGAGAACGGTGACCTCAGTCCTTT
CAGTGGCATATCCCTAAGGGAACGGGCCTCAGATGCCTCCAGCCAGCTGTTCCATGTCCGGGCCCGGGAA
GGGTCCTTTGAAGCCAGATACCAGCAGCCATTTGAAGATTTCCGCATCTCGCAGGAGCATCTAGCAGACC
ATTTTGACAGTCGGGAACGAAGGGCCCCAAGAAGGACTCGGGTCAATGGAGACAACCGCCTCTAGTCAGA
CCCCACCTAGTTGGAGAGCAGCAGGTGCTGTCCACCTGTGGAATGCCATGAACTGGGTTCTCTGGGAGCT
GTCTACTGTAAAGCCTTCTTGGTCTCACAGCCTGGAGCCTGGATTCCAGCAGTGAAGGCTAGACAAAACC
AAGCCATTAATGATATGTATTGTTTTGGGCCTCCCTGCCCAGCTCTGGGTGAAGGCAAAAAACTGTACTG
TGTCTCGAATTAAGCACACACATCTGGCCCTGAATGTGGAGGTGGGTCCTTCCATCTTGGGCCAGGAGTA
GGGCTGAAGCCCCTTGGAAAGAGAAGTTGCCTCAGTTGGTGGCATAGGAGGTCTCAAGGAGCTGCTGACA
CATTCCTGAAAGAGGAGAAGGAGAAGGAGGAGGAGCCTTGGTGGGCCAGGGAAACAAAGTTTACATTGTC
CTGTAGCTTTAAAACCACAGGGTGAAAGAGTAAATGCCCTGCAGTTTGGCCCTGGAGCCAGGACAGAGGA
ATGCAGGGCCTATAATGAGAAGGCTCTGCTCTGCCCATGGAGGAAGACACAGCACAAGGGCACATTGCCC
ATGGCTGGGTACACTACCCAGCCTGAAAGATACAGGGGATCATGATAAAAATAGCAGTATTAATTTTTTT
TTCTTCTCAGTGGTATTGTAACTAAGTTATTCTGTCCTGCTCCTCACCTTGGAAGGGAAGACCCAGCACA
GAGCCTTTGGGAACAGCAGCTCTATGGGGTGTTGTACTGGGAGAGGGCACTGTCAAGAAGGGTGGAGGGG
CAGGAAGAGAGAAGAGCAATGTCTACCCTGGTGAGCTTTTTTGTTTTTATGACAAAGACGACTCGATATG
CTTCCCCTTAGGAATGGAGATATAGGTAAGTGGAGTCAGGCAGTAGGTACCAAATTAAGCTGCTGCTTGG
TGCAGTTTCTATGCAGTTGGTAAAAAGATGCAAAGGAGATGGGAAGGTTGGGAAGGTAAGCCCCACCTCT
GAGAACAGAGGCTGGGGTCCAGGCCTGTGGGTGCAAAGGTGCCTCAGCATAGCCAGCATCAGCACACGCA
AACCCACTGCCCAAATTTGGGCTCAGGGTTGGCCATTTGCTAGTTCTGCTGCCCTCTTAAGATCTGACTG
CCAAATAAATCATCCTCATGTCC
http://www.hsls.pitt.edu/molbio
Sample Exercises
1.
What is the %GC content of this Sequence?
2.
How many restriction enzymes cut this sequence
only once?
3.
If you cut the sequence with Kpn I and Hinc II, how
many DNA fragments will be generated?
4.
How many open reading frames (ORF) are present?
5.
Find the restriction enzymes with compatible ends
that can be used to excise the largest ORF.
http://www.hsls.pitt.edu/molbio
Sample Exercises Hints (NEBcutter)
1.
What is the %GC content of this Sequence?

2.
How many restriction enzymes cut this sequence
only once?

3.
Select Custom digest, then View gel
How many open reading frames (ORF) are present?

5.
Select for single cutters
If you cut the sequence with Kpn I and Hinc II, how
many DNA fragments will be generated?

4.
See top left of page (after entering sequence info)
Select ORF summary
Find the restriction enzymes with compatible ends
that can be used to excise the largest ORF.

Select the ORF, then locate multiple cutters, cut positions
http://www.hsls.pitt.edu/molbio
Webcutter 2.0

http://bio.biomedicine.gu.se/cutter2/

Free
Major features:







Rainbow cutters Highlight your favorite enzymes in color or
boldface for easy at-a-glance identification
Silent cutters Find sites which may be introduced by silent
mutagenesis of your coding sequence
Sequence uploads Input sequences directly into Webcutter from
a file on your hard drive without needing to cut-and-paste
Degenerate sequences Analyze restriction maps of sequences
containing ambiguous nucleotides like N, Y, and R.
Circular sequences Choose whether to treat your sequence as
linear or circular
Enzyme info Click into the wealth of references and ordering
information at New England BioLabs' REBASE, directly from your
restriction map results
http://www.hsls.pitt.edu/molbio
Webcutter
find alternate versions of the
DNA which will translate into
the same amino acid
sequence, but contains a
new restriction site
http://www.hsls.pitt.edu/molbio
Webcutter
Mutate CCGGGT to CCCGGG to introduce
Sma I cutting site without changing translation
http://www.hsls.pitt.edu/molbio
Webcutter—silent mutagenesis
click here to retrieve sample
sequence, then copy/paste into box
http://www.hsls.pitt.edu/molbio
Webcutter—results
http://www.hsls.pitt.edu/molbio
Webcutter—specific restriction enzymes
http://www.hsls.pitt.edu/molbio
Thank you!
Any questions?
Carrie Iwema
[email protected]
412-383-6887
Ansuman Chattopadhyay
[email protected]
412-648-1297
http://www.hsls.pitt.edu/molbio
Sequence Manipulation
www.vam.ac.uk/images/image/44010-large.jpg
http://www.hsls.pitt.edu/molbio
Sequence Manipulation Tools

READSEQ


http://www-bimas.cit.nih.gov/molbio/readseq/
Sequence Manipulation Suite

http://www.bioinformatics.org/sms2/
http://www.hsls.pitt.edu/molbio
READSEQ
Format your sequence
any way you want
http://www.hsls.pitt.edu/molbio
READSEQ—change formats
click here to retrieve sample
sequence, then copy/paste into box
http://www.hsls.pitt.edu/molbio
READSEQ—FASTAGenBank
FASTA
GenBank
http://www.hsls.pitt.edu/molbio
Sequence Manipulation Suite
http://www.hsls.pitt.edu/molbio
SMS—filter DNA
http://www.hsls.pitt.edu/molbio
removes non-DNA
characters from text
SMS—reverse complement
converts DNA to its reverse
and/or complement counterpart
http://www.hsls.pitt.edu/molbio
SMS—group DNA
http://www.hsls.pitt.edu/molbio
adjusts the spacing
of DNA sequences
and adds numbering
SMS—primer map
creates a map of the
annealing positions
of PCR primers
http://www.hsls.pitt.edu/molbio
SMS—DNA pattern find
locates regions that match
a sequence of interest
http://www.hsls.pitt.edu/molbio
SMS—DNA stats
finds # of occurrences
of each residue
http://www.hsls.pitt.edu/molbio
SMS—translate
converts DNA
sequence into protein
http://www.hsls.pitt.edu/molbio

similar documents