Big Idea #2 & 3: Structure Meets Function of Nucleic Acids

Report
Big Idea #2 & 3: Structure Meets
Function of Nucleic Acids
Replication
Transcription
Translation
Replication
• What function of DNA does this process
accomplish?
– Role of DNA polymerase
Diversity
• Mutation is the
ultimate source for
diversity.
• Mutation ONLY
occurs during
replication!
Transcription and Translation
Transcription
• Where?
• Why is DNA read
“backwards?”
• Molecules involved:
– RNA polymerase:
Moves in the 5’ to 3’
direction…so what
strand does it READ?
– DNA-->mRNA
Translation
• Where?
• How does the concept
of structure meets
function apply?
• Molecules involved:
– mRNA “codons”
– tRNA “anticodons”
– rRNA
Function: DNA codes for
proteins
• Actually “mRNA” is
the “codon”
How can
changing DNA
change a protein?
A case study
• Sickle Cell:
– What change in the
DNA alters the shape
of the hemoglobin
protein?
– Why does this change
occur?
DNA Sequences
• HBB Sequence in Normal Adult
Hemoglobin (Hb A Protein)
– 3’CAAGTAAACATAGGACTTCTT 5’
• HBB Sequence in Mutant Adult
Hemoglobin (Hb S Protein)
– 3’CAAGTAAACATAGGACATCTT 5’
What to do?
• Determine the mutation that has been passed down
(replication).
• Determine the Amino Acid sequence (using
transcription and translation).
• Using an amino acid chart, determine WHY the
shape change might occur.
– Suggest what amino acid subsitutions may not have had
such a drastic effect.
– Suggest which amino acid subsitutions would have a
similar effect.

similar documents