Document

Report
More “What Perl can do”
With an introduction to BioPerl
Ian Donaldson
Biotechnology Centre of Oslo
MBV 3070
Much of the material in this lecture is from the
“Perl” lecture and lab developed for
the Canadian Bioinformatics Workshops by
Will Hsiao
Sohrab Shah
Sanja Rogic
And released under the Creative Commons license
http://creativecommons.org/licenses/by-sa/2.5/
More “What can Perl do”
• So far, we’ve had a very brief introduction
to Perl
• Next, we want to go a little deeper into
•
•
•
•
•
Use of “strict”
Perl regular expressions
Modules
An introduction to object-oriented Perl and
BioPerl
strict
Effects of “use strict”
• Requires you to declare variables
Correct
Incorrect
my $DNA;
$DNA = “ATCG”;
or
my $DNA = “ATCG”;
$DNA = “ATCG”;
• Warns you about possible typos in
variables
No warning
Warning
my $DNA = “ATCG”;
$DNA
=~tr/ATCG/TAGC/
my $DNA = “ATCG”;
$DAN
=~tr/ATCG/TAGC
Why bother “use strict”
• Enforces some good programming rules
• Helps to prevent silly errors
• Makes trouble shooting your program
easier
• Becomes essential as your code becomes
longer
• We will use strict in all the code you see
today and in your assignment
• Bottom line: ALWAYS use strict
Exercise
12
Write a program that has one function.
Use a variable named “$some_variable” in this
function and in the main body of the program.
Prove that you can alter the value of
$some_variable in the function without
changing the value of $some_variable in the
the main body of the program.
Try it yourself (15 minutes) then check the
answer at the end of this lecture.
regular expressions
What is a Regular Expression?
• REGEX provides pattern matching ability
• Tells you whether a string contains a pattern or
not (Note: it’s a yes or no question!)
Dog! Human’s best friend
“My dog ate my homework”
“Yesterday I saw a big
black dog”
“I have a golden retriever”
Regular Expression looking for “dog”
“Yes” or “True”
“Yes” or “True”
“No” or “False”
“No” since
REGEX is case
sensitive
Regular expressions are “regular”
Look at these names for yeast open reading frame names.
YDR0001W
YDR4567C
YAL0045W
YBL0008C
While they are all different, they all follow a pattern
(or regular expression).
1. Y means yeast
2. some letter between A and L represent a chromosome
3. an ‘R’ or ‘L’ refers to an arm of the chromosome
4. a four digit number refers to an open reading frame
5. A ‘W’ or a ‘C’ refers to either the Watson or Crick strand
You can write a regular expression to recognize ALL yeast
open reading frame names.
Perl REGEX example
my $text = “The dog ate my homework”;
if ($text =~ m/dog/){
print “The text contains a dog\n”;
}
• =~ m is the binding operator. It says: “does the
string on the left contain the pattern on the right?”
• /dog/ is my pattern or regular expression
• The matching operation results in a true or false
answer
Regular Expressions in Perl
• A pattern that match only one string is not very
useful!
• We need symbols to represent classes of characters
• For example, say you wanted to recognize ‘Dog’ or
‘dog’ as being instances of the same thing
• REGEX is its own little language inside Perl
– Has different syntax and symbols!
– Symbols which you have used in perl such as $ . { }
[ ] have totally different meanings in REGEX
REGEX Metacharacters
• Metacharacters allow a pattern to match
different strings
– Wildcards are examples of metacharacters
– /.og/ will match “dog”, “log”, “tog”, “ og”, etc.
– So . Means “any character”
– Perl REGEX has much more powerful
metacharacters used to represent classes of
characters
Types of Metacharacters
.
matches any one character or space except
“\n”
[]
in the
match?
denotes a selection of characters and
matches ONE of the characters
selection. What does [ATCG]
\t, \s, \n
match a tab, a space and a newline
respectively
\w
matches any characters in [a-zA-Z0-9]
\d
matches [0-9]
\D
matches anything except [0-9]
Using metacharacters to build a
regular expression
YBL3456W
/Y[A-L][RL]\d\d\d\d[WC]/
Is this a good pattern for a yeast ORF name?
What else does it match?
What if the name only has 3 digits?
REGEX Quantifiers
• What if you want to match a character
more than once?
• What if you want to match an mRNA with
a polyA tail that is at least 5 – 12 A’s?
“ATG……AAAAAAAAAAA”
REGEX Quantifiers
“ATG……AAAAAAAAAAA”
/ATG[ATCG]+A{5,12}/
• + matches one or more copies of the previous
character
• * matches zero or more copies of the previous
character
• ? matches zero or one copy of the previous
character
• {min,max} matches a number of copies within the
specified range
REGEX Anchors
• The previous pattern is not strictly correct
because:
– It’ll match a string that doesn’t start with ATG
– It’ll match a string that doesn’t end with poly
A’s
• Anchors tell REGEX that a pattern must occur at
the beginning or at the end of a string
REGEX Anchors
• ^ anchors the pattern to the
start of a string
• $ anchors the pattern to the end
of a string
/^ATG[ATCG]+A{5,12}$/
REGEX is greedy!
• The revised pattern is still incorrect because
– It’ll match a string that has more than 12 A’s at the end
• quantifiers will try to match as many copies of a sub-pattern
as possible!
/^ATG[ATCG]+A{5,12}$/
“ATGGCCCGGCCTTTCCCAAAAAAAAAAAA”
“ATGGCCCGGCCTTTCCCAAAAAAAAAAAA”
Curb that Greed!
• ? after a quantifier prevents REGEX from being
greedy
/^ATG[ATCG]+?A{5,12}$/
“ATGGCCCGGCCTTTCCGAAAAAAAAAAAA”
“ATGGCCCGGCCTTTCCGAAAAAAAAAAAA”
• note this is the second use of the question mark what is the other use of ? in REGEX?
REGEX Capture
• What if you want to keep the part of a
string that matches to your pattern?
• Use ( ) “memory parentheses”
“ATGGCCCGGCCTTTCCGAAAAAAAAAAAA”
/^ATG([ATCG]+?)A{5,12}$/
REGEX Capture
/^ATG([ATCG]+?)(A{5,12})$/
$1
$2
• What’s inside the first ( ) is assigned to $1
• What’s inside the Second ( ) is $2 and so
on
• So $2 eq “AAAAAAAAAAAA”
REGEX Modifiers
• Modifiers come after a pattern and affect
the entire pattern
• You have seen //g already which does global
matching (/T/g) and global
replacement(s/T/U/g)
• Other useful modifiers:
//i
make pattern case insensitive
//s
let . match newline
//m
let ^ and $ (anchors) match next to embedded
newline
///e
allow the replacement string to be a perl
statement
REGEX Summary
• REGEX is its own little language!!!
• REGEX is one of the main strengths
of Perl
•
•
•
•
•
•
To learn more:
Learning Perl (3rd ed.) Chapters 7, 8, 9
Programming Perl (3rd ed.) Chapter 5
Mastering Regular Expression (2nd ed.)
http://www.perl.com/doc/manual/html/pod/perlre.html
A good cheat sheet is:
http://www.biotek.uio.no/EMBNET/guides/guideRegExp.pdf
Exercise
13
In a text file, write out three strings that match
the following regular expression
/^ATG?C*[ATCG]+?A{3,10}$/
Write a program that reads each string from the text
file and checks your answers.
Try it yourself (30 min) then look at the answer at
the end of this lecture.
modules
What are Modules
• a “logical” collection of functions
• Using modules has the same advantage as using
functions; i.e., it simplifies code (makes it modular)
and facilitates code reuse
• Each collection (or module) has its own “name
space”
Name space:
a table containing the names of
variables and functions used in your
code
Why Use Modules?
• Modules allow you to use others’ code to
extend the functionality of your program.
• There are a lot of Perl modules.
Finding out what modules you
already have
In Perl, each module is a file stored in some
directory in your system.
The system that this class is using, stores Perl
modules (like cgi.pm) in one of two directories
C:\bin\Perl\lib
C:\bin\Perl\site\lib
Finding out what modules you
already have
• To find out where modules are installed, type
perl –V
at the command prompt
• To find out what is installed, type
perldoc perllocal
at the command prompt.
Using Modules
• To use a module, you need to include the
line:
use modulename;
at the beginning of your program.
• But you already knew that…
use strict;
use warnings;
Where to find modules
• You can search for modules (and
documentation) that may be useful to your
particular problem using
http://search.cpan.org/
• CPAN: Comprehensive Perl Archive
Network
• Central repository for Perl modules and
more
• “If it’s written in Perl, and it’s helpful and
free, it’s probably on CPAN”
• http://www.perl.com/CPAN/
Exercise
14
Open a web browser
Go to http://search.cpan.org/
Type in “bioperl Tools BLAST”
Follow the link to Bio::Tools::Blast
Browse through this page and the example code
Make a .plx file like this:
#bioperl example code
use strict;
use warnings;
#make the bioperl module (class) accessible to your program
use Bio::Seq;
print"ok - ready to use Bio::Seq";
Does this programme run or return an error?
Bioperl Overview
• The Bioperl project – www.bioperl.org
• Comprehensive, well documented set of
Perl modules
• A bioinformatics toolkit for:
•
•
•
•
•
Format conversion
Report processing
Data manipulation
Sequence analyses
and more!
• Written in object-oriented Perl
Bioperl Overview
• The last exercise most likely did not work
(unless you have BioPerl installed)
• So let’s install it…
How to install modules
• This class is using the active state version of Perl
that comes with a program called ppm (Perl
Package Manager)
• At the command prompt type
>ppm
And follow the instructions in the exercise 15
How to install modules (without ppm)
• If you are not using active state Perl, you
you can also install modules from CPAN
using:
>perl –MCPAN –e “install ‘Some::Module’”
• Module dependency is taken care of
automatically
• You’ll (usually) need to be root to install a
module successfully
Exercise
15
Install bioperl
1. At the command line prompt type
>ppm
2. Then at the ppm prompt type
ppm> search bioperl
3. Then type
ppm> install bioperl
Try this exercise at home. Installing
libraries is not possible at UiO
computers.
What are objects?
• Examples of objects in real life:
– My car, my dog, my dishwasher…
• Objects have ATTRIBUTES and METHODS
Some attributes of a my dog Fido:
•Color of fur = brown
•Height = 20 cm
•Owner’s Name = Ian
•Weight = 2 Kg
•Tail position = up
Some methods of my dog Fido:
•Bark
•Walk
•Run
•Eat
•Wag tail
Fido
What is a class?
• A class is a type of object in the real world:
– Cars, dogs, dishwashers…
• Classes have ATTRIBUTES and METHODS
Some attributes of a dog:
•Color of fur
•Height
•Owner’s Name
•Weight
•Tail position
Some methods of a dog:
•Bark
•Walk
•Run
•Eat
•Wag tail
The
concept
of a
“dog”
So an object is an instance of a class
class
The
concept
of “dog”
object
Fido
Objects have unique names called
“references” and classes have names too.
class
Dog
object
Class name
Fido
reference
All classes have a method called new that
is used to create objects.
class
Dog
object
Fido = new Dog();
reference
Fido
A reference to an object can be used to
access its properties or methods.
class
Dog
object
print Fido->bark(); Fido
woof
A reference to an object can be used to
access its properties or methods.
class
Bio::DB:
:RefSeq
object
$refseq = new Bio::DB::RefSeq;
$molecule = $refseq->get_seq_by_acc(“NP_01014”);
$refseq
$molecule = Some sequence record
Putting it all together
So now that you understand (sort of)
Classes
Objects
Attributes and
Methods
What remains is learning what the different classes ar
that are available in BioPerl and what you can do with t
For the next exercise, use the documentation at biope
to figure out what the following code does…
*see www.bioperl.org/wiki/HOWTOs and
doc.bioperl.org (then click on bioperl-live)
#! /usr/local/bin/perl
# Create and run a program which creates a Seq object and manipulates it:
use Bio::Seq;
Make the Bio::Seq class
available to my program
Exercise
16
# initiation of Seq object
$seq = Bio::Seq->new('-seq' =>'CGGCGTCTGGAACTCTATTTTAAGAACCTCTCAAAACGAAACAAGC',
'-desc' => 'An example',
Create a new Bio::Seq
'-display_id' => 'NM_005476',
object and initialize
'-accession_number' => '6382074',
some attributes
'-moltype' => 'dna');
# sequence manipulations
$aa = $seq -> moltype();
$ab = $seq -> subseq(5,10);
$ac = $seq -> revcom;
$ac1 = $ac -> seq();
$ad = $seq -> translate;
$ad1 = $ad -> seq();
# one of 'dna','rna','protein'
# part of the sequence as string
# returns an object of the reverse complemented sequence
# returns an object of the sequence translation
$ae = $seq -> translate(undef,undef,1); # returns an object of the sequence translation (using frame 1) (0,1,2 can be used)
$ae1 = $ae -> seq();
print "Molecule Type: $aa\n";
print "Sequence from 5 to 10: $ab\n";
print "Reverse complemented sequence: $ac1\n";
print "Translated sequence: $ad1\n";
print "Translated sequence (using frame 1): $ae1\n";
Exercise
17
Check out the code of several examples
using BioPerl at:
http://bip.weizmann.ac.il/course/prog2/perlBioin
fo/
More Bioperl modules
• Bio::SeqIO: Sequence Input/Output
– Retrieve sequence records and write to files
– Converting sequence records from one format
to another
• Bio::Seq: Manipulating sequences
–
–
–
–
Get subsequences ($seq->subseq($start, $end))
Find the length of the object ($seq->length)
Reverse complement a DNA sequence
Translate a DNA sequence
….etc.
• Bio::Annotation: Annotate a sequence
– Assign journal references to a sequence, etc.
– Bio::Annotation is associated with an entire
sequence record and not just part of a
sequence (see also Bio::SeqFeature)
Some more Bioperl modules
• Bio::SeqFeature: Associate feature annotation to
a sequence
– “features” describe specific locations in the
sequence
– E.g. 5’ UTR, 3’ UTR, CDS, SNP, etc
– Using this object, you can add feature
annotations to your sequences
– When you parse a genbank file using Bioperl,
the “features” of a record are stored as
SeqFeature objects
• Bio::DB::GenBank, GenPept, EMBL and
Swissprot: Remote Database Access
– You can retrieve a sequence from remote
databases (through the Internet) using these
objects
Even more Bioperl modules
• Bio::SearchIO: Parse sequence database search
reports
– Parse BLAST reports (make custom report)
– Parse HMMer, FASTA, SIM4, WABA, etc.
– Custom reports can be output to various
formats (HTML, Table, etc)
• Bio::Tools::Run::StandAloneBLAST: Run
Standalone BLAST through perl
– By combining this and SearchIO, you can
automate and customize BLAST search
• Bio::Graphics: Draw biological entities (e.g. a gene,
an exon, BLAST alignments, etc)
Bioperl Summary
• For Online documentation:
– For this workshop:
http://doc.bioperl.org/releases/bioperl-1.4/
– Tutorial: http://www.bioperl.org/wiki/HOWTO:Beginners
– HOWTOs: http://www.bioperl.org/wiki/HOWTOs
– Modules:
http://www.bioperl.org/wiki/Category:Core_Modules
• Literature:
– Stajich et al., The Bioperl toolkit: Perl modules for the
life sciences. Genome Res. 2002 Oct;12(10):1611-8.
PMID: 12368254
• Bioperl mailing list: [email protected]
– Best way to get help using Bioperl
– Very active list (upwards of 10 messages a day)
• Use with caution: things change fast and without
warning (unless you are on the mailing list…)
Perl Documents
• In-line documentation
– POD = plain old documents
– Read POD by typing perldoc <module name>
– E.g. perldoc perl, perldoc Bio::SeqIO
• On-line documentation
– http://www.cpan.org
– http://www.perl.com
– http:/www.bioperl.org
• Books
– Learning Perl (the best way to learn Perl if you know a bit
about programming already)
– Beginning Perl for Bioinformatics (example based way to
learn Perl for Bioinformatics)
– Programming Perl (THE Perl reference book – not for the
faint of heart)
Additional Book References
• Perl Cookbook 2nd edition (quick solutions to 80%
of what you want to do)
• Learning Perl Objects, References & Modules (for
people who want to learn objects, references and
modules in Perl)
• Perl in a Nutshell (an okay quick reference)
• Perl CD Bookshelf, Version 4.0 (electronic version
of the above books – best value, searchable, and
kill fewer trees)
• Mastering Perl for Bioinformatics (more example
based learning)
• CGI Programming with Perl (rather outdated
treatment on the subject... Not really
recommended)
• Perl Graphics Programming (if you want to
generate graphics using Perl; side note – Perl is
probably not the best tool for generating
graphics)
Answer 12
#!/usr/bin/perl
use strict;
use warnings;
#TASK: demonstrate the use of “my” in setting the
#scope of a variable
my $some_variable = 100;
#body of the main program with the function call
print "the value of some_variable is: $some_variable\n";
subroutine1();
print "but here, some_variable is still: $some_variable\n";
#subroutine using $some_variable
sub subroutine1{
my $some_variable = 0;
print "in subroutine1,some_variable
}
is: $some_variable\n";
#what happens if you comment out "use strict" and
#remove "my" from lines 7 and 16
#!/usr/bin/perl
use strict;
use warnings;
#TASK: check your answers to the regex excercise
#open input and output files
open(IN,"myanswers.txt");
#read the input file line-by-line
#for each line test if it matches a regular expression
while(<IN>){
chomp;
my $is_correct = does_it_match($_);
if ($is_correct){
print "$_ is a match\n";
}
else{
print "$_ is NOT a match\n";
}
}
#close input file and exit
close(IN);
exit();
#does it match
sub does_it_match{
my($answer) = @_;
my $is_correct = 0;
if ($answer =~ m/^ATG?C*[ATCG]+?A{3,10}$/){
$is_correct = 1;
}
return $is_correct;
}
Answer 13

similar documents