Transcription and Translation

Report
Transcription and Translation
Decoding DNA’s Information

DNA carries instructions on how to
make proteins



Each protein’s instructions are in a gene
These proteins determine your traits
We need to “photocopy” a gene in
order to produce the protein (trait)
RNA = Ribonucleic acid





Nucleic acid that is directly involved in the
making of proteins
The “photocopy” is called RNA
Genes – segments of DNA nucleotides
that code for specific proteins
DNA is in nucleus, but cell’s “machinery” to
make proteins is in the cytosol…how do we
follow DNA’s instructions?
RNA vs. DNA Structure

3 structural differences between
RNA & DNA:



1. RNA nucleotide has the sugar Ribose
(not deoxyribose)
2. RNA is single stranded
3. RNA uses the base Uracil (U) instead
of Thymine (T)

a. A pairs with U instead
RNA…the “link” between DNA
and Proteins


DNA must stay in the nucleus of a cell.
Proteins are assembled at the ribosomes (in the
cytoplasm).
3 different types of RNA used to make proteins:
1. mRNA = (messenger RNA) carries
information from DNA to Ribosomes.
2. tRNA = (transfer RNA) reads the mRNA and
brings the correct amino acid to build
the protein.
3. rRNA = (ribosomal RNA) part of the
Ribosome that grabs on to the mRNA to
position it for protein synthesis to
occur.
Protein Structure




Made up of amino acids
Polypeptide- string of amino acids
20 amino acids are arranged in
different orders to make a variety of
proteins
Assembled on a ribosome
Replication
DNA
•DNA double helix unwinds
•DNA now single-stranded
•New DNA strand forms using
complementary base pairing (A-T, C-G)
•Used to prepare DNA for cell division
•Whole genome copied/replicated
Transcription and Translation: An
Overview (aka the Central Dogma)
DNA
Transcription
RNA
Translation
Protein
RNA vs. DNA



DNA
Double stranded
Deoxyribose sugar
Bases: C,G A,T



RNA
Single stranded
Ribose sugar
Bases: C,G,A,U
Both contain a sugar, phosphate, and base.
Transcription


The information contained in DNA is stored in
blocks called genes
 the genes code for proteins
 the proteins determine what a cell will be
like
The DNA stores this information safely in the
nucleus where it never leaves
 instructions are copied from the DNA into
messages comprised of RNA
 these messages are sent out into the cell to
direct the assembly of proteins
Transcription

The path of information is often referred to
as the central dogma
DNA 

RNA  protein
The use of information in DNA to direct the
production of particular proteins is called
gene expression, which takes place in
two stages

transcription is the process when a messenger
RNA (mRNA) is made from a gene within the DNA

translation is the process of using the mRNA to
direct the production of a protein
Transcription

RNA forms base
pairs with DNA



C-G
A-U
Primary transcriptlength of RNA that
results from the
process of
transcription
TRANSCRIPTION
ACGATACCCTGACGAGCGTTAGCTATCG
UGCUAUGGGACU
WHY is TRANSCRIPTION Important?



It is needed to get the DNA message out of
the nucleus so the ribosomes know what
protein to make!
Without transcription, the ribosome would have
no idea what proteins the body needed and
would not make any.
You could NOT replace the hair that we loose
every day; could NOT grow long fingernails; be
able to fight off diseases; cells would fall apart
because the proteins were not being
replaced!!
TRANSCRIPTION
DNA is copied into a complementary
strand of mRNA.
WHY?
 DNA cannot leave the nucleus. Proteins
are made in the cytoplasm. mRNA
serves as a “messenger” and carries
the protein building instructions to the
ribosomes in the cytoplasm.
Please note that due to differing
operating systems, some
animations will not appear until
the presentation is viewed in
Presentation Mode (Slide Show
view). You may see blank slides
in the “Normal” or “Slide Sorter”
views. All animations will appear
after viewing in Presentation
Mode and playing each
animation. Most animations will
require the latest version of the
Flash Player, which is available at
http://get.adobe.com/flashplaye
r.
Major players in transcription

mRNA- type of
RNA that
encodes
information for
the synthesis of
proteins and
carries it to a
ribosome from
the nucleus
Major players in transcription

RNA polymerasecomplex of
enzymes with 2
functions:


Unwind DNA
sequence
Produce primary
transcript by
stringing together
the chain of RNA
nucleotides
mRNA Processing



Primary transcript
is not mature
mRNA
DNA sequence has
coding regions
(exons) and noncoding regions
(introns)
Introns must be
removed before
primary transcript
is mRNA and can
leave nucleus
Transcription is done…what now?
Now we have mature mRNA
transcribed from the cell’s DNA. It
is leaving the nucleus through a
nuclear pore. Once in the
cytoplasm, it finds a ribosome so
that translation can begin.
We know how mRNA is made, but
how do we “read” the code?
Translation


Second stage of protein production
mRNA is on a ribosome
Translation

To correctly read a gene, a cell
must translate the information
encoded in the DNA (nucleotides)
into the language of proteins
(amino acids)


translation follows rules set out by the
genetic code
the mRNA is “read” in three-nucleotide
units called codons

each codon corresponds to a particular
amino acid
Translation


The genetic code was determined
from trial-and-error experiments to
work out which codons matched
with which amino acids
The genetic code is universal and
employed by all living things
Figure 13.2 The genetic code
(RNA codons)
There are 64 different codons in the genetic code.
Translation

Translation occurs in ribosomes, which
are the protein-making factories of the
cell


each ribosome is a complex of proteins and
several segments of ribosomal RNA (rRNA)
ribosomes are comprised of two subunits



small subunit
large subunit
the small subunit has a short sequence of
rRNA exposed that is identical to a leader
sequence that begins all genes

mRNA binds to the small subunit
13.2 Translation

The large RNA subunit has three
binding sites for transfer RNA
(tRNA) located directly adjacent to
the exposed rRNA sequence on the
small subunit


these binding sites are called the A, P,
and E sites
it is the tRNA molecules that bring
amino acids to the ribosome to use in
making proteins
Figure 13.3 A ribosome is
composed of two subunits
Translation

The structure of a tRNA molecule is
important to its function



it has an amino acid attachment site at
one end and a three-nucleotide
sequence at the other end
this three-nucleotide sequence is called
the anticodon and is complementary
to 1 of the 64 codons of the genetic
code
activating enzymes match amino
acids with their proper tRNAs
Figure 13.4 The structure of
tRNA.
Translation

Once an mRNA molecule has bound
to the small ribosomal subunit, the
other larger ribosomal subunit binds
as well, forming a complete
ribosome


during translation, the mRNA threads
through the ribosome three nucleotides
at a time
a new tRNA holding an amino acid to
be added enters the ribosome at the A
site
Translation



Second stage of protein production
mRNA is on a ribosome
tRNA brings amino acids to the
ribosome
tRNA



Transfer RNA
Bound to one
amino acid on one
end
Anticodon on the
other end
complements
mRNA codon
tRNA Function


Amino acids must be in the correct
order for the protein to function
correctly
tRNA lines up amino acids using
mRNA code
Translation



Before a new tRNA can be added, the
previous tRNA in the A site shifts to the P
site
At the P site, peptide bonds from
between the incoming amino acid and the
growing chain of amino acids
The now empty tRNA in the P site
eventually shifts to the E site where it is
released
Figure 13.5 How translation
works
Translation


Translation continues until a “stop”
codon is encountered that signals
the end of the protein
The ribosome then falls apart and
the newly made protein is released
into the cell
WHY is TRANSLATION Important?
Makes all the proteins that the
body needs
 Without translation, proteins
wound not be made and we could
not replace the proteins that are
depleted or damaged

Please note that due to differing
operating systems, some
animations will not appear until
the presentation is viewed in
Presentation Mode (Slide Show
view). You may see blank slides
in the “Normal” or “Slide Sorter”
views. All animations will appear
after viewing in Presentation
Mode and playing each
animation. Most animations will
require the latest version of the
Flash Player, which is available at
http://get.adobe.com/flashplaye
r.
SUMMARY of PROTEIN
SYNTHESIS
DNA:
TAC CTT GTG CAT GGG ATC
mRNA AUG GAA CAC GUA CCC UAG
A.A
MET G.A HIS VAL PRO
STOP
IMPORTANT CODONS


AUG = start translation (Met)
UAA, UAG, UGA= stop translation
Please note that due to differing
operating systems, some
animations will not appear until
the presentation is viewed in
Presentation Mode (Slide Show
view). You may see blank slides
in the “Normal” or “Slide Sorter”
views. All animations will appear
after viewing in Presentation
Mode and playing each
animation. Most animations will
require the latest version of the
Flash Player, which is available at
http://get.adobe.com/flashplaye
r.
Figure 13.6 Ribosomes guide
the translation process
Ribosomes

2 subunits, separate in cytoplasm
until they join to begin translation



Large
Small
Contain 3 binding sites



E
P
A
Reading the DNA code



Every 3 DNA bases pairs with 3
mRNA bases
Every group of 3 mRNA bases
encodes a single amino acid
Codon- coding triplet of mRNA
bases
The Genetic Code










We now know the complete genetic
code
64 “words,” or codons
61 represent an amino acid
More than one codon for some
amino acids
AUG is the start signal and
represents methionine
UAG, UAA and UGA are the
stop signals
Universal
Non-overlapping
No spaces between codons
The language of amino acids is based on codons
1 codon =
3 mRNA nucleotides
1 codon =
1 amino acid
AUA U A U G C C C GC
How many codons are in this sequence of mRNA?
Using this chart,
you can determine
which amino acid
the codon “codes”
for!
Which amino acid
is encoded in the
codon CAC?
Find the first
letter of the
codon CAC
Find the
second letter
of the codon
CAC
Find the third
letter of the
codon CAC
CAC codes for
the amino
acid histidine
(his).
What does
the mRNA
codon
UAC code
for?
Tyr or tyrosine
Notice there is one start
codon AUG.
Transcription begins at
that codon!
Notice there are three
stop codons.
Transcription stops when
these codons are
encountered.


Although we do have proofreading
mechanisms in place, sometimes
mutations occur and a protein is not
translated properly.
Are there possible consequences to such
errors in transcription? Well, errors in
transcription will lead to the wrong codon
and incorrect translation of amino acid
and erroneous protein SO……. One disease
we see as and example on this is…….
The Genetic Code
Which codons code for which
amino acids?


Genetic code- inventory of linkages
between nucleotide triplets and the
amino acids they code for
A gene is a segment of RNA that
brings about transcription of a
segment of RNA
Transcription vs. Translation Review



Transcription
Process by which
genetic
information
encoded in DNA is
copied onto
messenger RNA
Occurs in the
nucleus
DNA
mRNA



Translation
Process by which
information
encoded in mRNA
is used to
assemble a protein
at a ribosome
Occurs on a
Ribosome
mRNA
protein
Chapter 14: Gene Technology
Biotechnology

Genetic engineering is the use of
technology to alter the genomes of
organisms.

Biotechnology includes genetic
engineering and other techniques to
make use of natural biological systems
to achieve an end desired by humans.
65
The Cloning of a Gene

Recombinant DNA Technology.

Uses at least two different DNA sources.

Vector used to introduce foreign DNA into a
host cell.


Plasmid.
Enzymes.


Restriction enzymes cleave DNA.
DNA ligase seals DNA into an opening
created by the restriction enzyme.
66
67
Polymerase Chain Reaction

Polymerase Chain Reaction (PCR)
can create millions of copies of a
DNA segment very quickly.

Can be subjected to DNA fingerprinting
using restriction enzymes to cleave the
DNA sample, and gel electrophoresis to
separate DNA fragments.
68
69
Biotechnology Products
Products
Effects and Uses
Anticoagulants
Involved in dissolving blood clots; used
to treat heart attack patients
Colony-stimulating factors
Stimulate white blood cell production,
used to treat infections and immune
system deficiencies (e.g.; lupus)
Growth factors
Stimulate differentiation and growth of
various cell types; used to aid wound
healing (e.g.; burn victims)
Human Growth Hormone (HGH)
Used to treat dwarfism
Insulin
Involved in controlling blood sugar
levels; used in treating diabetes
Interferons
Disrupt the reproduction of viruses;
used to treat some cancers
Interleukins
Activate and stimulate white blood cells;
used to treat wounds, HIV infections,
cancer, immune deficiencies
70
Biotechnology Products


New prostate cancer vaccine (FDA app. Apr 2010)
Treats patients advanced form of prostate cancer.




Provenge : The series of three shots using a patient's
own cells, and are designed to train the immune system
to recognize and kill malignant cells.
Does NOT cure cancer, just make patients live
longer (avg: 4 months)
$50-75K price range
Still in testing stage
Biotechnology Products

Transgenic Bacteria.



Insulin.
Human Growth Hormone.
Transgenic Plants.

Pest resistance.

Higher yields.
72
Genetic Engineering of Farm
Animals

Transgenic Animals.

The use of transgenic farm animals to
produce pharmaceuticals is currently
being pursued.

Cloning transgenic animals.

Dolly (1997).
73
Genetic Engineering of Farm
Animals

Production of bovine somatotropin
(BST) 1994



Became commercially available for
dairy farmers to increase animals’ milk
production
More money
Although BST is functional, harmless,
and sanctioned by the FDA, much
controversy exists over whether it is
actually desirable.
74
Genetic Engineering of Crop Plants

Manipulation of the genes of crop
plants to make them more resistant to
disease from insects and improve crop
yield.

Cotton:
Over 40% of the chemical insecticides used
for these crops
 Bacillus thuringiensis (Bt)
 Harmful to caterpillars/tomato hornworms but
not harmful to humans
 81% of U.S acreage is Bt cotton

Genetic Engineering of Crop Plants



60-70% of processed foods in the U.S.
grocery shelves have genetically
modified ingredients.
Table 14.2 (pg. 265)
List of Genetically Modified Crops
Is eating genetically modified food
dangerous?



EPA, FDA, and USDA approve food
regulations in the U.S.
EPA approved EPSP enzyme (change
in protein sequence) for human
consumption
Bt (inhibits pests on cotton/corn
crops) protein is approved for human
consumption by the EPA
Benefits vs Risk

Benefits:




Increased pest and disease resistance
Drought tolerance
Increased food supply
Farmers make more money and keep
food cost down for consumers
Benefits vs Risk

Risk:





Introducing allergens and toxins in
foods
Antibiotic resistance
Adversely changing the nutrient
content of a crop
Creation of “super” weeds and other
environmental risk
Unknown long-term health effects
So, do you think that it is safe to
eat genetically modified foods?

This is for you to decide…

similar documents