PowerPoint *********

Report
131028 Mie Meeting Research, Yasuhito Shimada
eci2 knockout in Zebrafish using CRISPR-Cas9 System
The diverse potential application of CRISPR-Cas9 system.
Nat Methods. 10: 957-963, 2013 (Figure 2C)
Purpose:
To construct eci2 knockout zebrafish.
The CRISPR Design Tools
1. ZiFit Targeter Version 4.2 (ZINC Finger Consortium, Joung Lab, Massachusetts General Hospital): Nat Biotechnol. 31: 227229, 2013
2. CRISPR Design (Zhang Lab, Broad Institute of MIT and Harvard): Nat Biotechnol. 31: 827-832, 2013
①
②
③
eci2 mRNA sequence
(not genome sequence)
1
④
Results
Check by Genome-blast
Remove the oligo covered to
exon-intron boundary
⑤
Sequence Name
eci2
eci2
eci2-Reverse Strand
eci2
eci2
eci2-Reverse Strand
eci2-Reverse Strand
eci2-Reverse Strand
eci2
eci2
eci2
eci2-Reverse Strand
eci2
eci2
eci2-Reverse Strand
eci2-Reverse Strand
eci2-Reverse Strand
Start
166
243
264
337
403
456
477
646
782
783
1006
1065
1105
1186
1261
1289
1401
Targetsite
GGAGGATTTCAACAAGGCCA
GGGCTCCATCTCACAGGAGG
GGTGTTGCAGGGTCCTACCG
GGGTCTGGGCTCCATCTCAC
GGGAGCAGAAGCCCCTGCAG
GGAGACCAGCAGCGTCTGGA
GGTGGTGATGTTGTCTTCTG
GGATCTTGGTAAAGTTGTTG
GGGGTTTCGGTCACTCTGTT
GGGTTTCGGTCACTCTGTTG
GGAAAGCTCCTTCCAGTCAG
GGACAGAGCCAGAGAATTTT
GGAGGAAGAGAAGCTTCACG
GGCCATCATGAGCTTCTTCC
GGTTAACTTGGGAAAAGTGA
GGAACTGCGTTTGACAGCCA
GGACGTAAAACACTGTTCAG
End Blast second hit
185
16
362
17*
283
15
356
17
422
17
475
16
496
17
665
16
801
15
802
15
1025
17
1084
16*+
1124
17*
1205
16
1280
17*+
1308
16
1420
17
Oligo 1
TAGGAGGATTTCAACAAGGCCA
TAGGGCTCCATCTCACAGGAGG
TAGGTGTTGCAGGGTCCTACCG
TAGGGTCTGGGCTCCATCTCAC
TAGGGAGCAGAAGCCCCTGCAG
TAGGAGACCAGCAGCGTCTGGA
TAGGTGGTGATGTTGTCTTCTG
TAGGATCTTGGTAAAGTTGTTG
TAGGGGTTTCGGTCACTCTGTT
TAGGGTTTCGGTCACTCTGTTG
TAGGAAAGCTCCTTCCAGTCAG
TAGGACAGAGCCAGAGAATTTT
TAGGAGGAAGAGAAGCTTCACG
TAGGCCATCATGAGCTTCTTCC
TAGGTTAACTTGGGAAAAGTGA
TAGGAACTGCGTTTGACAGCCA
TAGGACGTAAAACACTGTTCAG
Oligo 2
AAACTGGCCTTGTTGAAATCCT
AAACCCTCCTGTGAGATGGAGC
AAACCGGTAGGACCCTGCAACA
AAACGTGAGATGGAGCCCAGAC
AAACCTGCAGGGGCTTCTGCTC
AAACTCCAGACGCTGCTGGTCT
AAACCAGAAGACAACATCACCA
AAACCAACAACTTTACCAAGAT
AAACAACAGAGTGACCGAAACC
AAACCAACAGAGTGACCGAAAC
AAACCTGACTGGAAGGAGCTTT
AAACAAAATTCTCTGGCTCTGT
AAACCGTGAAGCTTCTCTTCCT
AAACGGAAGAAGCTCATGATGG
AAACTCACTTTTCCCAAGTTAA
AAACTGGCTGTCAAACGCAGTT
AAACCTGAACAGTGTTTTACGT
Notes
Order
Order
Order
Order
* first hitがない
+ Chr24ではない
Positive controls
fh: Zebrafish-gRNA-0004 (site #2)
gsk3b: Zebrafish-gRNA-0005
(Nat Biotechnol. 2013, Supplementary)
Plasmid Purchase from Addgene
1. Cut: Cas9 nucleases
2. Nick: Cas9 nickases
3. Interfere: CRISPR interference (CRISPRi)
4. Active: dCas9-activator fusion
2
⑥
Amp
Kan
Plasmid Construction
1. DR274 linearization using BsaI
⑦
⑧
2.1kbp
DR274-1 (365ng/ul)
6 ul (2 ug)
10 x CutSmart
2
SDW
11.5
BsaI-HF (20 U/ul)
0.5
2.
37℃, 1h
65℃, 20min
Electrophoresis on 1.5% Agarose gel
Gel Extraction using Wizard SV Gel and PCR Clean-Up System (Promega)
Measure the concentration using NanoDrop (35 ng/μl in 50 μl)
Annealing for insert oligonucleotides using 1 ×annealing solution (Life Technologies)
⑨
3.
Ligation using Ligation-convenience Kit (Wako Pure chemicals) and Transformation
Plasmid : Insert DNA = 1 : 5
The size of plasmid = 2147 - extra bp = 2100 bp
The MW = 660 x 2100 = 1386000
34.37 ng/ul = 24.8 nM
Linearized DR274 (25 nM)
2 μl (final 2.5 nM)
DNA template (1/20: 200 nM)
1 μl (final 10 nM)
SDW
7
2 x Ligation Mix
10
Total
20
Transformation
a.
DR274 (positive control)
b.
DR274-linealized
c.
Ligated DR274 (gsk3b)
10 min at 16℃.
3

similar documents