1 D1S80 – genetisk markör för studier av människa

Report
D1S80 – exempel på genetisk
markör för studier av människa
Bioresursdagar för gymnasielärare
Uppsala 18-19 november 2013
Ammie Berglund
www.bioresurs.uu.se
Laboration
SYFTE: exempel på hur man kan arbeta med
moderna biologiska metoder i genteknik och
engagerande med analys av eget DNA.
METOD:
• DNA-extraktion från kindceller (Chelex-metod)
• PCR för kopiering av D1S80-området
• Gelelektrofores för analys av genotyper
Ammie Berglund
([email protected])
Koppling till styrdokumenten
Centralt
innehåll
Biologi 1
• Arvsmassans uppbyggnad, ärftlighetens lagar och
mekanismer. Celldelning, DNA-replikation, mutationer
• Genetikens användningsområden.
Möjligheter, risker och etiska frågor
• Evolutionärt perspektiv på molekylärbiologi
Biologi 2
• Cell- och molekylärbiologins användningsområden
Möjligheter, risker och etiska frågor
• Enklare molekylärbiologiska metoder
• Användning av genetiska data för studier av biologiska
sammanhang
Ammie Berglund
([email protected])
Genetiska data & genetiska markörer
•
•
•
•
Hela genom-DNA-sekvenser
Delar av DNA – gener & genetiska markörer
Lämplig nivå av variation?
Frågeställningen avgör!
Jämföra arter? Jämföra populationer inom art?
Identifiera individer? Jämföra gener?
• Sekvensvariation – kräver sekvensering
• Längdvariation – OK med gelelektrofores
• D1S80 en variabel markör med längdvariation
Ammie Berglund
([email protected])
Hur ser området D1S80 ut?
locus D1S80 på
kromosom 1
Ammie Berglund
([email protected])
Repeterade enheter
Upprepade
enheter om
16 baser
Vanligaste
nukleotidsekvensen
hos en ”enhet”
Ammie Berglund
([email protected])
Exempel på D1S80-alleler
ABCDDECGHIKKIIHII HIJIILG (530 bp allel nr 24)
GAAACTGGCCTCCAAACACTGCCCGCCGTCCACGGCCGGCCGGTCCTGCGTGTGA
ATGACTCAGGAGCGTATTCCCCACGCGCCAGCACTGCATTCAGATAAGCGCTGGCT
CAGTGTCAGCCCAAGGAAGACAGACCACAGGCAAGGAGGACCACCGGAAAGGA
AGACCACCGGAAAGGAAGACCACCGGAAAGGAAGACCACAGGCAAGGAGGAC
CACCGGAAAGGAAGACCACCGGCAAGGAGGACCACCGGCAAGGAGGACCACCA
GGAAGGAGGACCACCAGCAAGGAGGACCACCAGCAAGGAGGACCACCAGGAAG
GAGGACCACCAGGAAGGAGGACCACCGGCAAGGAGGACCACCAGGAAGGAGG
ACCACCAGGAAGGAGGACCACCGGCAAGGAGGACCACCAGGAAGGAGAACCAC
CAGGAAGGAGGACCACCAGGAAGGAGGACCACCAGGAAGGAGGACCACTGGCA
AGGAAGACCACCGGCAAGCCTGCAAGGGGCACGTGCATCTCCAACAAGAC
ABCDDECHHIIILG (370 bp allel nr 14)
GAAACTGGCCTCCAAACACTGCCCGCCGTCCACGGCCGGCCGGTCCTGCGTGTGA
ATGACTCAGGAGCGTATTCCCCACGCGCCAGCACTGCATTCAGATAAGCGCTGGCT
CAGTGTCAGCCCAAGGAAGACAGACCACAGGCAAGGAGGACCACCGGAAAGGA
AGACCACCGGAAAGGAAGACCACCGGAAAGGAAGACCACAGGCAAGGAGGAC
CACCGGAAAGGAGGACCACCGGCAAGGAGGACCACCGGCAAGGAGGACCACC
AGGAAGGAGGACCACCAGGAAGGAGGACCACCAGGAAGGAGGACCACTGGCAA
GGAAGACCACCGGCAAGCCTGCAAGGGGC ACGTGCATCTCCAACAAGAC
Ammie Berglund
([email protected])
Populationsanalyser av D1S80-variation
0.35
Finsk population
Frekvens av olika
D1S80-alleler
0.3
0.25
0.2
0.15
0.1
0.05
0
18
19
20
Allel 18 och 24 vanligast
Ammie Berglund
([email protected])
21
22
23
24
25
26
27
28
29
30
31
37
Lämplig markör för skolan?
•
•
•
•
Inte en proteinkodande sekvens
Inte kopplad till någon egenskap
Relativt enkelt separera alleler (16 bp skillnad)
Att känna till:
deletionssyndrom &
hemizygoti (”falsk homozygot” pga deletion)
• Forskare i medicinsk genetik säger OK
• Gör inga släktskapsanalyser!
Ammie Berglund
([email protected])
Tänkbara frågeställningar
• Är allelerna 18 och 24 de vanligaste för D1S80
i gruppen/klassen?
• Hur stor variation i antal alleler och antal
genotyper får vi i gruppen/klassen?
Ammie Berglund
([email protected])
Exempel på resultat och tolkning av gel
Här är BRUNNARNA!
STORLEKSSTANDARD
500 bp (baspar)
400 bp (baspar)
300 bp (baspar)
200 bp (baspar)
100 bp (baspar)
D1S80 ger DNA-fragment i storleksområdet
300-800 bp (baspar)
Ammie Berglund
([email protected])
Linjär regression – verktyg för att bestämma
storlek på DNA-fragmenten
Storlek (bp)
1000
900
800
700
600
500
400
300
200
100
14
12
10
8
Avstånd (cm)
2,7
2,9
3,2
3,5
4,2
5,1
6,3
8
10
13
log10
0,431364
0,462398
0,50515
0,544068
0,623249
0,70757
0,799341
0,90309
1
1,113943
6
Vilken längd har DNA-fragmentet som
ligger 6,7 cm från brunnen?
4
2
0
0
200
400
600
350 bp ???
800
1000
1200
Ammie Berglund
([email protected])
Log-diagram ger rätlinjigt samband
Vilken längd har DNA-fragmentet som
ligger 6,7 cm från brunnen?
Beräkna log10-värdet
för 6,7 = 0,826
Beräkna antalet baspar med
hjälp av den linjära funktionen
y = -1253,3*0,826 + 1438,6 = 403 bp
1200
1000
800
600
y = -1253.3x + 1438.6
R² = 0.9682
400
200
0
0
0.2
0.4
0.6
0.8
1
Ammie Berglund
([email protected])
1.2
Vilka alleler har jag?
Storlek allel
(bp)
(nr)
Storlek allel
(bp)
(nr)
Storlek allel
(bp)
(nr)
370
386
402
418
434
450
466
482
498
514
530
546
562
578
594
610
626
642
658
674
690
706
722
738
754
770
786
802
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
403 bp? (+/- 8 bp)
Ammie Berglund
([email protected])
34
35
36
37
38
39
40
41
Homo- eller heterozygot?
AHA – det är det som
menas med heterozygot…
• Beräkna andelen
heterozygoter
• Beräkna
allelfrekvensen:
antal alleler/totala
antalet alleler
(=2*antalet individer)
• Testa Hardy Weinbergjämvikt (p2+2pq+q2=1)
(dock många alleler…)
Ammie Berglund
([email protected])
Fler tips på frågor att diskutera
• Hur kan man förklara fenomenet att förekomsten av olika alleler
skiljer sig mellan olika delar av världen?
• Kan vi med hjälp av enbart D1S80 få några ledtrådar om vi
försökte identifiera en person t ex i ett kriminalfall?
• Vilka felkällor kan förklara att det inga band syns på gelen?
• Tänkbara förklaringar för bandmönster med fler än två band?
• Några etiska frågor som påverkar användningen av den här
typen av genetiska markörer?
• Vilka D1S80-genotyper kan avkomman få om du väljer två olika
bandmönster från klassens resultat efter D1S80-analysen och
antar att de skaffar barn tillsammans? Ingen betydelse om du
tar två bandmönster som finns hos två personer av samma kön.
Analysera vilka genotyper deras avkommor kan få!
Ammie Berglund
([email protected])
Tidsplan
Måndag 18 november
Kl. 10.45-11.30
Intro Barcoding-lab (DNA-prep start)
Kl. 12.30-14.00/14.30–16.00 (byte Gr1/2)
Grupp 1 – D1S80-lab
DNA-extraktion, PCR-start,
Gel-gjutning
Grupp 2 – Barcoding-lab DNA-extraktion
PCR-start
Kl. 16-17 Info om ett webprojekt om GM-växter
Tisdag 19 november
Kl. 8.30-9.15
Start gelelektroforeser
Kl. 9.30-10.30
Barcoding – datalab
Kl. 10.30-11.30
Gelavläsning/tolkning D1S80
Ammie Berglund
([email protected])

similar documents