
X03006; SV 1; linear; mRNA; STD; MAM; 620 BP.
28-JAN-1986 (Rel. 08, Created)
12-SEP-1993 (Rel. 36, Last updated, Version 2)
Bovine mRNA for lens beta-s-crystallin
beta-crystallin; beta-gamma-crystallin; crystallin.
Bos taurus (cow)
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
Eutheria; Laurasiatheria; Cetartiodactyla; Ruminantia; Pecora; Bovidae;
Bovinae; Bos.
PUBMED; 4054100.
Quax-Jeuken Y.E.F.M., Driessen H., Leunissen J., Quax W.J., de Jong W.,
Bloemendal H.;
"Beta-s-crystallin: structure and evolution of a distinct member of the
EMBO J. 4(10):2597-2602(1985).
Data kindly reviewed (06-MAR-1986) by Y. Quax-Jeuken
Sequence Retrieval System
an indexing and retrieval system for
flat file databases
Q: Which sequences in EMBL [do not]
encode for a protein for which the 3D
structure is known?
Command line SRS
Using getz
Retrieve the UniProt entry for the protein with
accession number P19558:
getz "[uniprot-acc:P19558]" -e
Count the human proteins in the UniProt database:
getz "[uniprot-org:human]" –c
Print sequence of the rice proteins in the UniProt
database that have a length between 10 and 50 aa:
getz "[uniprot-org:rice]&[uniprot-sl#10:50]" -f sl
Give the id and description for all A.thal proteins
that have at least 8 transmembrane domains:
getz '[swissprot-org:arabidopsis thaliana]<
&[swissprot-CountedN#8:]))' -f "id des"
Count the human protein sequences in the NCBI RefSeq
getz "[refseqp-org:human]" –c
Count the human mRNA sequences in the NCBI RefSeq
getz "[refseq-org:human]&[refseq-mol:mrna]" –c
Retrieve the mRNA sequences for all human proteins in
the NCBI RefSeq database in fasta format :
getz "[refseqp-org:human]>[refseq-mol:mrna]" –d –sf fasta
MRS: A fast and compact retrieval system for
biological data. Hekkelman M.L., Vriend G.
European Molecular Biology
Open Software Suite
"European Molecular Biology Open Software Suite"
Toolbox with bioinformatics applications
command line / shell
Useful EMBOSS commands
Displays information on the currently available
Finds programs by keywords in their one-line
Reads the manual entries for each program in EMBOSS
Finds the relevant programs of certain program
Reads and writes (returns) sequences
Reads and writes (returns) flatfile entries
Extract features from a sequence
Extract regions from a sequence
Translate nucleic acid sequences
Get help from EMBOSS itself
# showdb
Shows the currently available databases
# tfm wossname
How to use a EMBOSS command? Just (r)tfm it
# wossname alignment
Which commands can handle alignments?
# seealso seqret
Are there any other commands able to do the
similar thing?
Command line options
• All EMBOSS programs react to a number of
command line options. The most important
ones are
–help –verbose
Get help
Get elaborate help
“no questions asked”
Write to standard output
Read stdin, write stdout
SEQRET parameters
zonnebloem> seqret -help
Standard (Mandatory) qualifiers:
(Gapped) sequence(s) filename and optional
format, or reference (input USA)
seqoutall [<sequence>.<format>] Sequence set(s)
filename and optional format (output USA)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
Use feature information
Read one sequence and stop
General qualifiers:
Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
SEQRET parameters
zonnebloem> seqret -help -verbose
Standard (Mandatory) qualifiers:
(Gapped) sequence(s) filename and
format, or reference (input USA)
seqoutall [<sequence>.<format>] Sequence set(s)
filename and optional format (output USA)
Additional (Optional) qualifiers: (none)
Advanced (Unprompted) qualifiers:
Use feature information
Read one sequence and stop
Associated qualifiers:
"-sequence" associated qualifiers
Start of each sequence to be used
SEQRET parameters
"-sequence" associated qualifiers
Start of each sequence to be used
End of each sequence to be used
Reverse (if DNA)
Ask for begin/end/reverse
Sequence is nucleotide
Sequence is protein
Make lower case
Make upper case
Input sequence format
Database name
UFO features
Features format
Features file name
SEQRET parameters
"-outseq" associated qualifiers
Output seq format
File name extension
Base file name
Output directory
Database name to add
Separate file for each entry
UFO features
Features format
Features file name
Output directory
SEQRET parameters
General qualifiers:
Turn off prompts
Write standard output
Read standard input, write standard output
Prompt for standard and additional values
Write debug output to program.dbg
Report some/full command line options
Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
Report warnings
Report errors
Report fatal errors
Report dying program messages
Universal Sequence Address
A sequence file "xxx.seq" in any format
A sequence file "xxx.seq" in fasta format
EMBL entry PAAMIR, using whatever access method is defined locally
for the EMBL database
EMBL entry X13776, using whatever access method is defined locally
for the EMBL database and searching by accession number and entry
name (X13776 is the accession number in this case)
EMBL entry X13776, using whatever access method is defined locally
for the EMBL database and searching by accession number only
EMBL entry PAAMIR, using whatever access method is defined locally
for the EMBL database, and searching by ID only
EMBL entries containing the word 'lectin' in the Description line
EMBL entries containing the wildcarded word 'human' in the Organism
EMBL entries PAAMIB, PAAMIE and so on, usually in alphabetical
order, using whatever access method is defined locally for the EMBL
Universal Sequence Address
db or db:*
embl or EMBL:*
All sequences in the EMBL database
Reads file mylist and uses each line as a separate USA. List files can
contain references to other lists files or any other standard USA.
Same as "@mylist" above
'getz -e [embl-id:paamir] |'
The pipe character "|" causes EMBOSS to fire up getz (the SRS
sequence retrieval program) to extract entry PAAMIR from EMBL in
EMBL format. Any application or script which writes one or more
sequences to stdout can be used in this way.
So far the shortest USA we could invent. In 'asis' format the name is
the sequence so no file needs to be opened. This is a special case. It
was intended as a joke, but could be quite useful for generating
command lines.
'program parameters |'
Each of the above can have '[start : end]' or '[start : end : r]' appended to them.
The 'file' and 'dbname' forms of USA can have 'format::' in front of them
(although a database knows which format it is and so this is redundant and
Walk through exercise
For a protein with UniProt Accession number:
find the nucleotide sequence that encodes this (repeated)
amino acid fragment:
Getting the sequence
seqret -auto uniprot:Q5ZKN6 -stdout
>Q5ZKN6_CHICK Q5ZKN6 SubName: Full=Putative uncharacterized protein;
Getting the sequence
seqret -auto uniprot:Q5ZKN6 -stdout
>Q5ZKN6_CHICK Q5ZKN6 SubName: Full=Putative uncharacterized protein;
Run a program within Perl: 3 ways
$seq = `seqret -auto uniprot:Q5ZKN6 stdout`;
system("seqret -auto uniprot:Q5ZKN6 stdout");
open SEQRET,"seqret -auto uniprot:Q5ZKN6 stdout|";
while(my $line = <SEQRET>) {
if($line !~ /^>/) {
$seq .= $line;
close SEQRET;
my $lsOutput = `ls -l`;
put shell commands or programs in
backticks to run from Perl. The
output can be stored in a variable.
open LS,"ls -l|";
The open function can run a program
and read its output. The pipe symbol
"|" links the output to a filehandle.
Find the fragment’s position
my $seq = "";
open SEQRET,"seqret -auto uniprot:Q5ZKN6 stdout|";
while(my $line = <SEQRET>) {
if($line !~ /^>/) {
$seq .= $line;
close SEQRET;
# look for location of the repeat
my $position = index($seq, "VAEEVAEE") + 1;
# print the offset
print "Position = ", $position, "\n";
opposite of "=~ "gives true if the
search found no hits.
Get a cross-reference to EMBL
entret uniprot:Q5ZKN6 -auto stdout |grep "DR
Get the feature table of this protein entry
Understand the cross-reference
DR EMBL; AJ720048; CAG31707.1; -; mRNA.
Link to EMBL
EMBL accession number
Status identifier
Protein ID
Molecule Type
Database cross reference
The corresponding
cross reference
Read the detailed documentation of UniProt cross reference
Get a cross-reference to EMBL
entret uniprot:Q5ZKN6 -auto stdout | grep "DR
|grep "EMBL;"
In Perl, use a regular expression to locate the EMBL
reference line, and extract the EMBL accession number
and the protein-ID
Link protein to coding DNA
extractfeat embl:AJ720048 -value CAG31707.1 stdout
Returns the DNA coding for protein CAG31707.1 (=Q5ZKN6)
Figure out the offset in DNA
Offset in amino acid sequence: 128
Offset in corresponding nucleotide sequence:
((128-1) x 3) + 1
(128 x 3)-2
= 382
Position is from 382 to (382 + 8x3)=406
Figure out the position of its corresponding coding DNA
sequence (is there anything wrong here?)
Extract the DNA sequence
extractfeat embl:AJ720048 -value CAG31707.1
stdout | extractseq –filter -reg "382-406"
Now we got the corresponding DNA sequence for
the protein fragment
It should be: “gttgctgaggaggttgctgaagaac”
But is that correct? Let's translate it for verification…
Verify the result
extractfeat embl:AJ720048 -value CAG31707.1
stdout | extractseq –filter -reg "382-406"
| transeq -filter
Result is “VAEEVAEEX” but not “VAEEVAEE”
What’s wrong here?
Always try to verify your results: computers make
very few errors, but that is not true for people...
Build a pipeline in Perl to perform the previous steps
of the walkthrough (from slide 34)
Test it with the UniProt protein A0L7N9
Find the fragment at offset 305 that is 8 aa long
Find out the coding DNA of this amino acid fragment
and verify it

similar documents