Prise en charge du cancer à l*heure de l*oncogénétique

Report
Prise en charge du cancer
colorectal à l’heure de
l’oncogénétique et des thérapies
ciblées
AIT-KACI.H, CHERID.MC, TERKI.N
CPMC
Les examens de BM réalisées à partir des
tumeurs humaines peuvent permettre une
optimisation de l’offre de soins aux
patients atteints de cancer.
 L’étude à l’échelon moléculaire des
tumeurs peut permettre une
thérapeutique ciblée, donc adaptée à
chaque patient.

<< Médecine personnalisée>>
TESTS RER
Le syndrome de Lynch aussi nommé syndrome
HNPCC est un syndrome génétique héréditaire
prédisposant aux cancers CR et de l’endomètre.
Lié à l’existence d’une mutation constitutionnelle,
ds le génome de l’individu, sur l’un des gènes de la
famille MMR.
Gène MLH1 ou MSH2 ou MSH6 rarement PMS2
Gène MMR: DNA is atch epair, ou gène de
réparation des erreurs de mésappariement
de l’ADN
Il n’y a pas de caractéristique clinique qui
permet de reconnaitre aisément un
syndrome de lynch ( KC âge jeune).
Sur le plan tumoral il existe des
caractéristiques non pathognomoniques
(phénotype RER positif) Replicative ERror,
temoin indirect d’une altération d’un gène
MMR.
Plus de 95% des tumeurs CR développées dans le
cadre d’un syndrome HNPCC présentent un
phénotype RER positif.
15% des tumeurs sporadiques présentent un
phénotype RER positif.
Les mécanismes menant à ce phénotype sont
différents, il s’agit d’une altération somatique (au
niveau de la tumeur et non pas au niveau du
génome) d’un gène MMR le plus souvent MLH1.
Deux types d’analyses caractérisent le phénotype
RER
•La recherche d’instabilité micro satellitaire.
•L’extinction immunohistochimique des
protéines MMR.
 Choix
par le pathologiste d’un bloc comportant
tumeur + tissu sain
 -IHC : hMLH1 (clone G168-728, 1:70) et hMSH2
(clone FE11, 1:100). hMSH6 (et hPMS2) à la
demande
 Perte totale par les cellules tumorales exigée,
avec témoins internes (cellules épithéliales et
lymphocytes) positifs
 -PCR : 2 coupes de 10mm du même bloc sans
macro-ni microdissection, extraction ADN, PCR
pentaplexmononucléotidique(Suraweeraet al,
Gastroenterology2002),
 MSI > 2 marqueurs instables
hMLH1
hMSH2
Résultats IHC MMR
•MLH1 et MSH2 «systématiques» (pas de contexte)
–Pas de perte : MSS, pas de Lynch
–Perte MLH1 : Lynch MLH1 ou sporadique MSI
–Perte MSH2 : Lynch MSH2
•Contexte évocateur Lynch :
–Perte MLH1 ou MSH2 : idem
–Pas de perte MLH1 ni MSH2, faire MSH6 et PMS2
•Perte MSH6 : Lynch MSH6
•Perte PMS2 : Lynch PMS2
•Pas de perte : sans doute pas Lynch (mais voir PCR MSI et
consultation oncogénétique +++)
IHC Avantages :
Oriente sur la protéine et donc le gène en
cause
Largement disponible
Contrôle morphologique
Inconvénients :
Type et panel d’AC variables
Dépend de la fixation
Sensibilité ne peut être parfaite
IHC cible un gène précis et permettra
ensuite de centrer l’analyse sur ce gène
Immunohistochimie MMR
•JR Jass, 2005 :
« The fact that the pathologist can contribute
to the diagnosis of a serious disorder by
using a strategy that is both simple and costeffective represents an important medical
advance »
•LA Aaltonen, 2006 :
« Immunohistochemistry is the ideal method,
there is no benefit doing both. MSI is control
for IHC »
Instabilité micro satellitaire (MSI)
En premier lieu, on étudie la stabilité des MSS, 2 statuts possibles
MSI-L ( les MS sont soit stables ou très peu instables)
MSI-H ( les MS sont très instables)
Les MS sont de courtes séquences ADN formées de la répétition
d’un motif lui même constitué de une à quatre bases, les plus
étudiés sont les répétitions (CA)
Les MS étudiées sont BAT25, BAT26, NR21, NR24, NR27.
GCTTCACACACACACACACACACATCC
GCTTCACACACACACACACACATCC
GCTTCACACACACACACACATCC
GCTTCACACACACACACATCC
BAT26
N
T
D17S250
N
T
PCR
Avantages :
 Conséquence fonctionnelle de l’inactivation
du MMR, indépendante du mécanisme.
 Caractère objectif (?)
Inconvénients :
 Disponibilité limitée
 Non contrôle morphologique (?)
 Panel variable selon les centres
MORPHOLOGIE DES CANCERS MSI
KRAS-un biomarqueur pour les traitements
anti-EGFR
 K-RAS est une protéine nœud de la
signalisation intracellulaire.
 Elle fonctionne comme un interrupteur(actif
liée au GTP et inactif liée au GDP).
 Les mutations kras se situent au niveau des
codons 12 et 13 ( elles sont de type
substitution de base et sont hétérozygotes).
Facteurs prédictifs… et à part KRAS?
Sur-expression EGFR ? (immunohistochimie)
1° biomarqueur prédictif potentiel évalué
GF
GF
CCRm
75%- 90% EGFR+ : 30% répondeurs
Tumeurs EGFR- : 25% répondeurs
idem poumon
P
P
P
P
Sur-expression
des récepteurs
Seuil de positivité = 1%
Cellule normale
GF
GF et récepteurs
GF
voies de
signalisation
régulation des
gènes qui
contrôlent le
cycle cellulaire
prolifération
régulée
GF
GF
P P
Cellule
cancéreuse
Activation
incontrôlée
GF et récepteurs GF
voies de signalisation
Dysrégulation gènes
du cycle cellulaire
prolifération
autonome
et dysrégulée
GF
GF
Effets des voies de signalisation intraNéo-angio genèse
cellulaire
Métastases
invasion
Division cellulaire
prolifération
Réparation et survie cellulaire
par blocage apoptose
Et KRAS dans tout ça?

Si KRAS muté
= court-circuit d’EGFR
P P KRASm
◦ activation constitutive de la protéine
KRAS
◦ non modulable par anti-EGFR
GF
Croissance cellulaire non contrôlée
Blocage EGFR sans intérêt
Etude immunohistochimique sur coupe en paraffine
Indication du test RER:
Nom et prénom:
Age:
Antécédent personnel:
Autres:
- Anti-hMLH1:
- Anti-hMSH2:
- Anti-hMSH6:
- Anti-PMS2:
PHENOTYPE RER:
. Cette analyse est effectuée sur de l’ADN extrait à partir d’un
fragment de tumeur
Matériel analysé: tissu congelé/fixé dans du formol 10%
Technique réalisée:
ADN extrait: amplifiable
MS
analysés
Phénotype
Conclusion
Bat26
Bat25
NR21
NR22
NR24

similar documents