AAAAAAA-3

Report
Our Service Portfolio
Nucleotide - based information
Transcripts :
mRNA
- SuperSAGE, ST-DGE
- RNAseq
- qRT-PCR, Taq-Man assays, Real-Time PCR service
- Normalization of cDNA libraries (qualitative information)
non coding RNA
- MicroRNA
- Degradome
Genomic DNA: - Digital karyotyping (DK), copy number variations (CNVs)
- Methylation-specific DK (MSDK)
- Genotyping
- Identification of SNPs
- Molecular markers
Transcriptome Analysis & Gene Discovery
SuperTag Digital Gene Expression Profiling
(ST-DGE)
A patented, improved version of SuperSAGE,
applying deep sequencing and a bias-free PCR
technology for optimal tag-to-gene annotation and
transcript quantification.
ST-DGE - SuperSAGE became better
How it works
SuperTag Digital Gene Expression (STDGE) profiling:
What gene is expressed and how often?
Anchoring Enzyme
Tagging Enzyme
5’
3’
cDNA
5’
3’
cDNA
5’
3’
cDNA
5’
3’
cDNA
Streptavidin-Beads
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
Sequencing of
Millions of 26
bp SuperTags
Counting, BLAST, Statistics
Digital Gene Expression Profiling
Principle
What Gene is expressed and how often ?
Streptavidin-Beads
1.Digestion with Anchoring Enzyme
5’
3’
5’
3’
5’
3’
5’
3’
cDNA
cDNA
cDNA
cDNA
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
Digital Gene Expression Profiling
Principle
What Gene is expressed and how often ?
Streptavidin-Beads
1.Digestion with Anchoring Enzyme
5’
3’
5’
3’
5’
3’
5’
3’
cDNA
cDNA
cDNA
cDNA
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
Digital Gene Expression Profiling
Principle
What Gene is expressed and how often ?
Streptavidin-Beads
1.Digestion with Anchoring Enzyme
2. First Linker Ligation
Linker 1
cDNA
3. Digestion with Tagging Enzyme
4. Recovery of Linker-Tags
Linker 1
Linker 1
Linker 1
cDNA
cDNA
cDNA
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
Highly specific 26bp “SuperTags“
Digital Gene Expression Profiling
Principle
What Gene is expressed and how often ?
Streptavidin-Beads
1.Digestion with Anchoring Enzyme
2. First Linker Ligation
Linker 1
Linker 2
Linker 1
Linker 2
Linker 1
Linker 2
Linker 1
Linker 2
3. Digestion with Tagging Enzyme
4. Recovery of Linker-Tags
5. Second Linker Ligation
5. PCR
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
TTTTTTT-5’
Digital Gene Expression Profiling
Principle
What Gene is expressed and how often ?
Streptavidin-Beads
1.Digestion with Anchoring Enzyme
2. First Linker Ligation
Linker 1
Linker 1
Linker 1
AAAAAAA-3’
Linker 2
TTTTTTT-5’
Linker 2
Linker 2
Linker
Linker1 1
Linker 1
Linker
Linker2 2
Linker 2
3. Digestion with Tagging Enzyme
4. Recovery of Linker-Tags
5. Second Linker Ligation
5. PCR
6. 2nd-Generation Sequencing
7. Counting of Tags, Bioinformatics
AAAAAAA-3’
TTTTTTT-5’
Sequencing of Millions of Tags
Linker 1
Linker 2
Linker 1
Linker 2
Linker 1
Linker 2
Linker 1
Linker 1
Linker 1
AAAAAAA-3’
TTTTTTT-5’
AAAAAAA-3’
Linker 2
TTTTTTT-5’
Linker 2
Linker 2
Counting, BLAST
SuperTag Digital Gene Expression Profiling
Quality
Quality of digital gene expression data depends on:
1. Quality of the Tag (what gene is expressed?)
2. Quantity of the Tags (how often is the gene expressed?)
Tag-Quality
The Tagging Enzyme determines Quality of Tags:
LongSAGE, other DGE platforms
18-21 bp
MmeI:
5’- GGGACNNNNNNNNNNNNNNNNNNNN -3’
3’- CCCTGNNNNNNNNNNNNNNNNNN -5’
SuperSAGE, SuperTag-DGE
EcoP15I :
26-27 bp (=SuperTAG)
5’-CAGCAGNNNNNNNNNNNNNNNNNNNNNNNNN
3’-GTCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNN
-3’
-5’
Tag Quality
What gene?
SuperTags allow unequivocal identification
of the corresponding gene
Enzyme
Plattform
Tag-Size
e-value
BsmFI-Tag
SAGE
14 bp
105
MmeI-Tag
LongSAGE, other platforms
18-20 bp
0,34
EcoP15I-Tag
SuperSAGE, ST-DGE
26-27 bp
0,00001
Tag Quality
Advantages of the SuperTAG
21 bp versus 26 bp
18-20bp (MmeI, LongSAGE)
26 bp (Ecop15I, SuperTAG)
BLAST-Hit , Mus musculus, Score = 52
?!
CATGGTGGCTCACAACCATC CATAAC
Immunoglobulin kappa chain complex
CATGGTGGCTCACAACCATC CGTAAT
Tumor necrosis factor (ligand) superfamily, member 10 ?!
CATGGTGGCTCACAACCATC TGTAGA
Homeodomain leucine zipper-encoding gene
?!
CATGGTGGCTCACAACCATC TGTATC
Mannose phosphate isomerase 1, transcript variant 4
?!
Only the 26 bp tag can differentiate between the transcripts !
Problem of PCR-introduced BIAS
Certain tags are preferentially amplified during PCR
biased quantification
The Solution: GenXPro’s bias-proof adapters (patent pending)
secure quantification
Downstream applications &
Advantages of the SuperTAG
26 bp SuperTAGs can:
• directly be used as highly specific primer for PCR
3‘- and 5‘- RACE, RCA, in vitro PCR, qRT-PCR: new
genes & non-model organisms can be analyzed.
• serve as specific probes: identification of genomic
or cDNA clones
• be directly spotted on a microarray for HT analysis1
• be used for the simultaneous analysis of two or
more organisms (pathogen/host)2
1. Matsumura et al. (2006) Nature Methods 3:469-474
2. Matsumura et al. (2003) PNAS 100: 15718-15723
RNA-Seq vs. ST-DGE
(deepSuperSAGE)
Mean transcript size : 2 500 bp
AAAAAAA-3’
TTTTTTT-5’
5’cDNA
3’
RNA-Seq
SuperTag size:
26 bp
STDGE
For the same depth of analysis, RNA-Seq requires
20-100 times more sequencing !!
*Asmann et. al 2009
Normalization of cDNA libraries
Transcript frequencies in human pancreas
Frequencies of transcript species
Most of the transcript species are
expressed at low levels (below 10 copies
per million).
Total transcript distribution
Frequent transcripts make up 50 % of
all transcripts:
To get the info of rare transcripts, these
50% need to be sequenced as well...
Digital Gene Expression vs. Microarrays
Major Advantages of SuperTAG-DGE versus Microarrays
• No false positives, no cross hybridisation
• Open architecture platform: any gene detected, novel
genes, unexpected transcripts, antisense transcripts
• Reliable quantification of the transcriptome:
counts vs. semi-quantitative light signal intensities
• Higher dynamic range: unlimited vs. log2<3
• Rare transcripts are exactly quantified
• Simultaneous analysis of more than one organisms: parasite-host
Digital Gene Expression vs. Microarrays
SuperTAG-DGE includes rare Transcripts
About 80–95% of all mRNA species are present in
five or fewer copies per cell. These rare transcripts
make up 35–50% of all the mRNAs.
SuperSAGE-Analysis: Transcript Frequencies
Example: 4.455.653 Tags from Mouse Spleen (Mus musculus)*
101-1000
0,41%
6-20
17%
1000-10.000
0,16%
21-100
8%
>10.000
0,01%
More than 75 % rare transcripts:
Only this part
1
is visible
for
43%
microarrays
This information
is lost on microarrays !
2-5, 32%
>18.000 different transcripts excluding the singletons
* >13.000 Singletons with distinct matches to the NCBI-DB
ST-DGE
A Genome-Wide TaqMan Assay
Similar expression tendency in TaqMan assays and ST-DGE
Log2 foldchange Taqman assays vs. ST-DGE*
Log2 foldchange SuperSAGE
Log2 foldchange Taqman
5
3
2
1
-1
-2
-3
-4
Invariably expressed house
keeping gene Aurora-Kinase A
-6
-7
-8
*in developing chicken embryo gonads
SuperTAG vs. Micro-arrays
Comparable data:
Exact number for every transcript vs. semiquantitative values
(Microarrays, RT-PCR)
microRNAs and the degradome
microRNA
mRNA-ends
AAAAAAA-3’
AAAAAAA-3’
mRNA
AAAAAAA-3’
AAAAAAA-3’
Next-Gen-Sequencing, counting, BLAST
Digital Karyotyping (DK)
Methylation-specific Digital Karyotyping (MS-DK)
Quantification of short fragments of genomic DNA
to identify chromosomal changes, amplifications, deletions, and the
presence of foreign DNA sequences.
1.
First enzyme digestion
(methylation-sensitive)
5‘
3‘
2.
5‘
3‘
DNA
First linker ligation, binding to matrix
Biotin
3‘
5‘
Digital Karyotyping (DK)
Methylation-specificDigital Karyotyping (DK)
3.
Second enzyme digestion (methylation-insensitive)
5‘
3‘
4.
Biotin
Second linker ligation, EcoP15I digestion
5‘
3‘
SuperTag 26bp
Biotin
Sequencing
Counting,
Annotation
Thank you for your attention
www.genxpro.de

similar documents