HER-2+ PIK3CA

Report
A DAGANATGENOMIKAI KUTATÁSOK
EREDMÉNYEINEK GYAKORLATI HASZNOSÍTÁSA
AZ EMLŐDAGANATOK CÉLZOTT KEZELÉSÉBEN
ACTGACTGACTGACTGACTGACTGACTG
010101010101010101010101010101010
PETÁK ISTVÁN
, PINTÉR FERENC, VÁRKONDI EDIT, KIRSCH KLÁRA, KOHÁNKA ANDREA, PONGOR
LŐRINC, SCHWAB RICHÁRD, KOPPER LÁSZLÓ
KPS DIAGNOSZTIKA ZRT. BUDAPEST; MTA-SE PATHOBIOKÉMIAI MUNKACSOPORT,
ORVOSI VEGYTANI INTÉZET, SEMMELWEIS EGYETEM, BUDAPEST, I. PATOLÓGIAI ÉS
KÍSERLETI RÁKKUTATÓ INTÉZET, SEMMELWEIS EGYETEM, BUDAPEST
GENOMIC LANDSCAPE OF BREAST CANCER: 2012
„100 tumours, we found driver mutations in at least 40 cancer genes
and 73 different combinations of mutated cancer genes. „
ROAD FROM THE CANCER GENOME PROJECT
TO THE THERAPY
START
GOAL
1
CANCER
GENOME
PROJECT
3
4
5
TARGETED
CLINICAL
PATIENT
DATA
MOLECULAR
PHYSICIANS
RESEQUENCING ANALYSIS INTERPRETATION NAVIGATION ASSISTANCE
OF PATIENT
SAMPLES
SEQUENCE
CANCER
GENES
2
MUTATIONS
DRUGS
WHERE?
HOW?
THERAPY
1
TARGETED RESEQUENCING PANELEK
Illumina HiSeq™
2000 platform for
2574 exons
representing 176
genes captured using
Agilent SureSelect™
MGH's Diagnostic Molecular
Pathology lab
SNaPshot assay, hotspot
mutations in 14 oncogenes
50 to 60 patients per week
50% acionable
mutations
NEXT: NGS 50 to 150
different targets
Genomweb September 19,
2012
+
in combination with
fluorescence in situ
hybridization
Módosított ION Cancer Panel
50 gén 200 amplicon
ABL1, AKT1, ALK, APC, ATM,
BRAF, CDH1, CDKN2A, CSF1R,
CTNNB1, EGFR, ERBB2, ERBB4,
FBXW7, FGFR1, FGFR2, FGFR3,
FLT3, GNAS, HNF1A, HRAS,
IDH1, JAK2, JAK3, KDR, KIT,
KRAS, MET, MLH1, MPL,
NOTCH1, NPM1, NRAS,
PDGFRA, PIK3CA, PTEN,
PTPN11, RB1, RET, SMAD4,
SMARCB1, SMO, SRC, STK11,
TP53, VHL.+ egyedi gének,
BRCA, DDR1
+
FISH:
EGFR, HER-2, FGFR, ALK, MET
MOLEKULÁRIS PATOLÓGIAI VIZSGÁLATOK ÚJ GENERÁCIÓJA
A
B
1-180 amplicon
1- 12 gén 1-400 amplicon
C
12 gén 40 amplicon
HER-2, EGFR, ALK, MET, FGFR
1
50 gén 200 amplicon
AZ IONTORRENT NGS TECHNOLÓGIA VALIDÁCIÓJA ISMERT
MUTÁCIÓKAT TARTALMAZÓ SEJTVONALAKKAL ÉS
A MAGYAR PATOLÓGUS TÁRSASÁG MINŐSÉGBIZTOSÍTÁSI
KÖRVIZSGÁLATÁBAN
1
2
3
4
5
Reference
Variant
Status
Max %
H358 %
H1650 %
ref-EGFR-E19N1
EGFR-2236_2250del15
ref-EGFR-E21K1
Accepted
92,81
0
0,03
0
92,81
EGFR-2573T>G=L858R
Accepted
60,31
0
0
60,31
0
ref-K-RAS-E2N1
K-RAS G34T=G12C
Accepted
47,66
47,66
0
0
0
ref-EGFR-E20N4
EGFR-2369C>T=T790M
Accepted
45,33
0
0
45,33
0
ref-EGFR-E19N1
EGFR-2235_2249del15
Accepted
44,87
0
44,87
0
0
1
H1975 % HCC827 %
ÚJ GENERÁCIÓS SZEKVENCIA KIÉRTÉKELŐ ALGORITMUS
„A HEURAA (HEURISTIC AMPLICON ANALYZER) PROGRAM”
2
ÚJ GENERÁCIÓS SZEKVENCIA KIÉRTÉKELŐ ALGORITMUS
„A HEURAA (HEURISTIC AMPLICON ANALYZER) PROGRAM”
Simulated datasets
SNP(1)
Deletion (18bp)
Experimental datasets
Cell line HCC827
Cell line H1975
Exon 19 DEL
T790M
No of hits
No of hits
Time
Time (sec)
(sec)
(% correct)
(% correct)
997564
1641
913
998142 (99.8)
(97.88)
144
16116 (0)
95
19173 (19.1)
893382
379 985512 (30.3)
212
(88.48)
Algorithm:
Time
(sec)
%
Time
(sec)
%
BWA [1]
1264
100
1276
100
Bowtie [2]
88
100
152
0
Bowtie2 [3]
146
100
146
100
Mrsfast [4]
14
100
14
0
15
68280 (0)
16
640727 (64)
Mosaik [5]
3860
100
3870
0
4926
1426
HeurAA
7,1
100
6,9
100
23
83784 (0)
1000000
(100)
254718 (25.4)
1000000
(100)
2
25
TARGETED DRUG SENSITVITY DATABASE (18 GENES)
Mutáció hatása a
gyógyszerzékenység
re
Érzékenyítő
Vad típussal egyező
Hyperlink to Pubmed or Cosmic
3
Sejtvonalas vagy enzimes adatok
alapján
IC50(mut)≤0,9*IC50(wt)
0,9*IC50(wt)<IC50(mut)≤1,1*I
C50(wt)
Vad típushoz képest
1,1*IC50(wt)<IC50(mut)≤Cma
kevésbé érzékeny
x
Rezisztenciát okozó
Cmax<IC50(mut)
Klinikai
adatok
alapján
<wt
CR, PR
≈wt
MR, SD
Kapcso
lat
P
>wt
>wt(r
es)
PD, NR
N
TARGET-DRUG ASSOCIATION ANALYZER
3
EVIDENCIA ADATBÁZIS
3
„ACTIONABLE” GÉNEK (18 GÉN A FORGALMBAN LÉVŐ CÉLZOTT (22)
GYÓGYSZEREKKEL KAPCSOLATBAN)
3
ABL
imatinib, nilotinib, dasatinib
ALK
crizotinib
BRAF
vemurafenib
EGFR
gefitinib, erlotinib, cetuximab
FLT3
sunitinb
HER2
lapatinib, trastuzumab, pertuzumab
HER4
lapatinib
HRAS
cetuximab, panitumumab
KIT
imatinib, sunitinib, dasatinib, nilotinib
KRAS
erlotinib, cetuximab, panitumumab
MET
crizotinib
NRAS
cetuximab, panitumumab
PDGFRA
pazopanib, sunitinib, sorafenib
PIK3CA
everolimus, temsirolimus, metformin, cetuximab, anti-ösztrogének
PTEN
everolimus, metformin, cetuximab, anti-ösztrogének
RET
vandetanib, sunitinib
SRC
dasatinib
VEGFR2
pazopanib, sorafenib, sunitinib
FROM THE CANCER GENOME PROJECT
TO TARGETED THERAPIES
OLD MODELL
NEW MODELL
4
CÉLZOTT KLINIKAI VIZSGÁLATOK CÉLPONT ALAPÚ RENDSZEREZÉSE
CLINICAL TRIALS FOR
COLON CANCERS
INDEPENDENTLY FROM THE
MOLECULAR PROFILE
CLINICAL TRIALS FOR
PIK3CA M+ COLON CANCERS
CLINICAL TRIALS FOR
PIK3CA M+ SOLID TUMORS
INDEPENDENTLY FROM THE
HISTOTYPE
COLON CANCER / PIK3CA M+
4
BIOMARKER
PIK3CA
INHIBITORS
ORGAN
LINE
TYPE
OTHER
MARKER
………..
PIK3CA
BKM120
COLON
2nd
Phase I,II
PIK3CA M+
………..
PIK3CA
BYL719
SOLID
TUMORS
2nd
Phase I.
PIK3CA
M+/AMP
………..
PIK3CA
temsirolimus
SOLID
TUMORS
-
Phase I
PIK3CA/
PTEN M+
………..
………..
………..
………..
………..
………..
………..
………..
A BETEG ÉS A KEZELŐORVOS SEGÍTESE ABBAN HOGY A BETEG
TÉRÍTÉSMENTESEN
HOZZÁFÉRJEN A CÉLZOTT GYÓGYSZERHEZ (PATIENT ASSISTANCE)
1. COMPASSIONATE USE PROGRAMOK
(PL. ALK 4/3 BETEG KPS SZERVEZÉS (PFIZER)
2. GYÁRI ADOMÁNYOK
(PL. EGFRM+ NSCLC (ASTRA, ROCHE)
3. KLINIKAI VIZSGÁLATOK
(CLINICAL TRIAL NAVIGATOR)
4. EGYEDI MÉLTÁNYOSSÁGI ENGEDÉLYEK
5
5. KIEGÉSZÍTŐ BIZTOSÍTÁSOK
JELÁTVITELI TÁMADÁSPONTOK EMLŐDAGANATOKBAN
trastuzumab
16-27% (CNG)
20-30% (CNG)
HER-2
pertuzumab
HER-2
FGFR
ALK/EML4
HER-2
16% (CNG)
2-12% (M+)
C-MET
EGFR
KIT
lapatinib
PDGFR
2-3% (M+)
KRAS
HRAS
2-7% (M+)
25-40% (M+)
PIK3CA
NRAS
4% (M+)
AR
BRAF
AKT/PKB
PTEN
50% (del)
ER
1% (M+)
MEK
PR
MTOR
everolimus
HER-2
Trastuzumab
Lapatinib
Cell line IC 50 = 30 nM
More sensitive than wild type
Pertuzumab
Less sensitive than wild type
WT
Resistant
Lapatinib
Trastuzumab
Lapatinib
Trastuzumab
Lapatinib
Cell line IC50 =146 nM
p.V773A ,1
Lapatinib
Cell line IC50 = 125 nM
p.T862A, 1
Lapatinib
Cell line IC50 = 75 nM
p.N857S, 1
Lapatinib
Cell line IC50 = 2600 nM
p.G776L, 1
Trastuzumab
HER-2 somatic mutations
(in COSMIC database)
Mutated samples : 166
Total samples : 10260
http://www.sanger.ac.uk/genetics/CGP/cosmic/
Drug sensitivity data: manual searching in PubMed
Lapatinib
Cell line IC50 > 2000 nM
p.L755P, 2
p.H878Y, 2
Lapatinib
Cell line IC50 = 14 nM
Lapatinib
Cell line IC50 = 1545 nM
Lapatinib
More sensitive than wild type
HER-2
Lapatinib
Cell line IC50 = 496nM
Less sensitive than wild type
Trastuzumab
Lapatinib
Cell line IC50 = 286 nM
Resistant
Lapatinib
Cell line IC50 = 249nM
Lapatinib
Cell line IC50 = 96 nM
Trastuzumab
Lapatinib
Cell line IC50 =1433 nM
Lapatinib
Cell line IC50 = 461nM
Lapatinib
Cell line IC50 = 3339 nM
Lapatinib
Cell line IC50 =894 nM
Lapatinib
Cell line IC50 = 407nM
Lapatinib
Cell line IC50 =670 nM
Trastuzumab
Trastuzumab
Lapatinib
Cell line IC50 = 3273 nM
Lapatinib
Cell line IC50 =1056 nM
Lapatinib
Cell line IC50 = 1127nM
HER-2 mutations
(not in COSMIC database)
Lapatinib
Cell line IC50 = 253 nM
Lapatinib
Cell line IC50 = 1154nM
Lapatinib
Cell line IC50 = 2861nM
PARALLEL DRIVER MUTÁCIÓK HER-2+ DAGANATOKBAN
PTEN
PIK3CA
MET
KRAS
ALK
NINCS MÁS MUTÁCIÓ
EGFR
BRAF
A PIK3CA/PTEN MUTÁCIÓK JELENETŐSÉGE
A HER-2 GÁTLÓ ÉRZÉKENYSÉGBEN
HER-2 HER-2
PIK3CA
HER-2
HER-2
~50%
~50%
PTEN
PIK3CA
WT
PTEN
M+
Trastuzumab 66,7%
P=0,02
18,2%
Lapatinib
P=0,05
81,3%
41,7%
JCO 2011/01 20/2
EMLŐDAGANATOK MOLEKULÁRIS SPEKTRUMA
EGFR M+
HER-2 CNG
1-10%
15%
EGFR CNG
10%
HER FISH+
EGFR GÁTLÓK
HER-2 CNG
+PK3CA/
PTEN
15%
AKT
4%
MEK
1%
KRAS 3%
FGFR
20%
MET+
?%
ALK
2,5%
BRAF
5%
HER-2+
PIK3CA/
PTEN
HER-2 GÁTLÓK
EGFR/HER-2 GÁTLÓK
PIK3CA+
20%
PIK3CA
INH
mTOR INH
AKT
INH
MEK
INH
BRAF
INH
MET INH
FGFR INH
MEK INH
ALK INH
A MOLEKULÁRIS PROFILVIZSGÁLATOK LEHETSÉGES KLINIKAI HASZNOSÍTÁSA
MAGYARORSZÁGON
TÁMOGATOTT, FORGALOMBAN LÉVŐ GYÓGYSZEREK, HAZAI KLINIKAI VIZSGÁLATOK
TRASTUZUMAB
LAPATINIB
LAPATINIB
M+
TRASTUZUMAB
LAPATINIB (!)
TRASTUZUMAB
LAPATINIB +HT HER-2/PIK3CA
EVEROLIMUS
EVEROLIMUS
TRASTUZMAB/
PERTUZUMAB
HT
HT+CHEMOTHERAPY
EVEROLIMUS
HER-2
ER+
GDC-0941,
GDC-0980,
ER+/PIK3CA
BM120,
HT+CHEMOTHERAPY
HER-2/
EGFR +
ER+/FGFR
AZD4547
DOVITINIB
TN
TN/ALK+
CHEMOTHERAPY
CRIZOTINIB
TN/BRCA+
VELIPARIB
TN/EGFRM+
GEFITINIB
KÖSZÖNÖM A MEGTISZTELŐ FIGYELMÜKET!
START
GOAL
CANCER
GENOME
PROJECT
PHYSICIANS
CANCER
GENES
THERAPY

similar documents