SNP discovery

Report
Fall 2014
HORT6033
Molecular
Plant Breeding
INSTRUCTOR: AINONG SHI
HORT6033 web site: http://comp.uark.edu/~ashi/MB
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 4 (09/03/2014)
I. SNP
II. SNP discovery by PCR
III.Example
IV.Homework
V.Question
Single Nucleotide Polymorphism (SNP)
SNP:
A single nucleotide (A, T, C or G)
mutation
Use:
• genetic and genome mapping,
• Association studies,
• Genetic diversity analysis, and
• Tagging important genes
Approach:
•
SNP discovery from PCR
• SNP discovery from High throughput Next generation sequencing (NGS) –
RNA-Seq, RAD-Seq, GBS etc.
(http://learn.genetics.utah.edu/content/p
harma/snips/)
SNP Discovery Tool
There are dozens of tools for SNP discovery. We will talk below two:
• BioEdit
Download: http://www.mbio.ncsu.edu/bioedit/page2.html
Manual: http://www.mbio.ncsu.edu/BioEdit/BioDoc.pdf
• DNASTAR Lasergene Genomics Suite
Download free TRY IT version : http://www.dnastar.com/tproducts-dnastar-lasergene-genomics.aspx and all use manuals can
also be downloaded or viewed from the web site.
SNP Genotyping
Single SNP genotyping assay:
• Taqman – Life Technologies
http://www.vetmed.ucdavis.edu/vme/taqmanservice/pdfs/SNP_Genotypin
g.pdf
• KASP genotyping - LGC Genomics
http://www.lgcgenomics.com/genotyping/kasp-genotypingchemistry/how-does-kasp-work/
Multiple SNP genotyping:
• SNP chip – Illumina
• Multiplex – Sequenom
SNP genotyping by next generation sequencing
• Genotyping by sequencing (GBS)
(http://cbsu.tc.cornell.edu/lab/doc/GBS_Method_Overview1.pdf)
• Restriction site associated DNA sequencing (RADseq)
(http://bfg.oxfordjournals.org/content/9/5-6/416.full.pdf+html)
SNP Discovery by PCR
Sw-5: AY007366
Primer Design
AAGCTTGGTGCAATGACATTATACAATCAACAAAGAATAGAAAGGAGATAAAAAGCACTATCCAAATCCC
-----------------------------------------------------------------------------------------------------------------------------------------TCCATTTTCCTTTTTTTGATTATTCCAGCTACCAAGACAACCACTAGGGGCAGTCCTTTGCATTTTTCTG
CTACTGCTTGACTCACATCTTGTAGTTCAAGCGGGCAATCTTCCTTTTGAAACACTTTTTTCTGCAACAA
TTGGCAACTCTCTTCTGTTGTGAGGAATGGAAGAGAATAAGGATCAGTATGGTACTTGACTTGCTTACCC
ACTTCTTCAAGTCGAGTTGTTACGACTATTCTGCTTCTAATTCCAACATCTGGAAAAGAAAGCCTTAAGT
CATCCCATACCATACAATCCCACATATCATCCAATACAATGAGATATCTCTTTCCCATTAATTTTCTCCT
CAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTTGAAACCTGTAACTTGACTGAAAATATCT
TGTAATAACTCTATCCGGTTATACGTTTGAGAAATGATGCACCATGCTCGAACATCAAAGCGAGAAACAA
TAATGTCATTATTGTACAACTTTCTAGCAATTGTCGTTTTCCCTTGTCCTCCCATGCCTACAATTGGGAC
AACGTCTAGCTCATTTGTACCTCTAGTCAGATAATCAATTAGTTCTTCTGCTTGTTTCTCAAAACCCACT
ACCTCCTCATCAGTTACAAGATTGCTATGTCGATCCGGCAGATGTTTTAATGGAGCAGCCACATAGTGAG
---------------------------------------------------------------------TTGGCTTAAAATAAGTTTTTTTTAACTTAAAATATGTTATTTTGAGTATTGACAAACAACTAAATAAGTC
AAAAATCAGCTTTTAAGTCAGTTTGACCACGCTCTCTTAT
Tool: Primer-BLAST
Sw5-f1 AACCACTAGGGGCAGTCCTT
Sw5-r1 CTCACTATGTGGCTGCTCCA
(TGGAGCAGCCACATAGTGAG)
PCR
PCR Product
Sequencing
Multiple Sequence
Alignment
SNP Discovery
SNP Validation
Accession
Gene
sw5-snp
Stevens
Sw-5b
31392
A
LA3667
Sw-5b
331
A
LA3433
sw-5b
331
G
LA2823
sw-5b
331
G
SNP Genotyping
SNP Discovery Using
BioEdit
1. Download and Install BioEdit
http://www.mbio.ncsu.edu/bioedit/bioedit.html
2. Example data: Sw-5 of gene of tomato
spotted wilt virus resistance
http://comp.uark.edu/~ashi/MB/example/Sw-5/sw5.fasta
1. Run BioEdit and Find SNPs
2. Example – SNP discovery in Tomato
http://comp.uark.edu/~ashi/MB/lecture/Shi_et_al_SNP-assay-tomato-diseaseresistance-2009aps.ppt
Fall 2014 HORT6033
Molecular Plant Breeding
Lecture 4 (09/03/2014)
Homework
1. Download Tm-2 gene sequences from NCBI web
site (GenBank), run BioEdit to find SNP markers for
Tm-2 locus of tomato mosaic virus resistanc
2. Download Sw-5 gene sequences from GenBank
and find SNP markers for Sw-5 alleles of spotted
wilt virus resistance
SNP Markers for Tm-2 locus in Tomato
AF536199_tm-2
AF536201_Tm2a
AF536200_Tm2
-----------------------------------------------------------------
-----------------------------------------------------------------
-----------------------------------------------------------------
TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT
TGATCGACGTAGCCTCATTCAACTTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT
AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAACATTTACTCATTGC
ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT
GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCAACCGTTAAGATATTATCAACATGTCGC
CCTGTGCCAAAGGCGCTAAAGGTTCTGAAGCTCAGGTTTTTCAGTGATCCGAGTGAGCAAATAAACTTGT
CATCCTATCCAAAAATTGTTAAGTTGCATTTGAATGTTGACAGAACAATAGCCTTGAACTCTGAAGCATT
CCCTCCAAATATTATCAAGCTTACTCTTGTCTGCTTTATGGTAGACAGTTGTCTACTGGCAGTGCTTAAG
ACATTACCCAAATTAAGAAAACTTAAAATGGTCATCTGCAAGTATAATGAAGAAAAGATGGCTCTCTCGG
GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA
------------------------------------------------------------____------
TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT
TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT
AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAATATTTACTCATTGC
ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT
GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGTTATCAATATTTAGC
CCTGTGCTTAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGAGTGAACAAATAAAGTTGT
CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAATCATT
TCCTCCAAATCTCATCAAGCTTACTCTAGCCTACTTTAGTGTAGACCGTTATATACTGGCAGTACTTAAG
ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGG
GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA
-----------------------------------------------------___--------------
TGGAGGGGAATATTTGTGGAAAACTGCCAAATAGTATTGTCAAGCTCACACGTCTAGAGACCATAGACAT
TGATCGACGTAGCCTCATTCAACCTCCTTCTGGTGTTTGGGAGTCTAAACATTTGAGACATCTTTGTTAT
AGAGATTATGGACAAGCATGTAACAGTTGCTTTTCTATAAGCTCATTTTACCCAAATATTTACTCATTGC
ATCCTAACAATCTACAAACCTTGATGTGGATACCTGATAAATTTTTTGAACCGAGGTTGTTGCACCGATT
GATCAATTTAAGAAAACTGGGTATACTGGGAGTGTCCAATTCTACCGTTAAGATGTTATCAATATTTAGC
CCTGTGCTCAAGGCGCTGGAGGTTCTGAAGCTCAGTTTTTCCAGTGACCCGAGTGAACAAATAAAGTTGT
CATCGTATCCACATATTGCTAAGTTGCATTTGAATGTTAACAGAACAATGGCCTTGAACTCTCAATCATT
TCCTCCAAATCTCATCAAGCTTACTCTAGCCAACTTTACGGTAGACCGTTATATACTGGCAGTACTTAAG
ACATTTCCCAAATTAAGAAAACTTAAAATGTTCATCTGCAAGTATAATGAAGAAAAGATGGATCTCTCGG
GCGAGGCAAATGGTTATAGCTTTCCGCAACTTGAAGTTTTGCATATTCATAGCCCGAATGGGTTGTCTGA
-----------------------------------------____-------------------------
Tool: Primer-BLAST
Primer Design
Tm2RS-f3 TGGAGGGGAATATTTGTGGA
Tm2RS-r3 ACTTCAGACAACCCATTCGG
(CCGAATGGGTTGTCTGAAGT)
PCR
PCR Product
Sequencing
Multiple Sequence
Alignment
SNP Discovery
SNP Genotyping
CAPS Marker Identification
SNP Genotyping
Reading
Varshney et al. 2009. Next-generation sequencing technologies and their
implications for crop genetics and breeding. Trends in Biotechnology
27:522–530 (Linked)
Liu et al. 2012. An improved allele-specific PCR primer design method for
SNP marker analysis and its application. Plant Methods 8: 34
(http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3495711/pdf/1746-48118-34.pdf)
Gaur et al. 2012. High-Throughput SNP Discovery and Genotyping for
Constructing a Saturated Linkage Map of Chickpea (Cicer arietinum L.). DNA
Res 19 (5): 357-373
(http://dnaresearch.oxfordjournals.org/content/19/5/357.full)
Shi et al. 2011. Identification of molecular markers for Sw-5 gene of tomato
spotted wilt virus resistance. American Journal of Biotechnology and
Molecular Sciences (1): 8-16. [PDF]
http://scihub.org/AJBMS/PDF/2011/1/AJBMS-1-1-8-16.pdf

similar documents